EMAIL THIS PAGE TO A FRIEND

GRIN2A

glutamate receptor, ionotropic, N-methyl D-aspartate 2A

327 Gene Product Result for
Synonyms: EPND GluN2A NMDAR2A NR2A
UniProtKB ID: Q12879, O00669, Q17RZ6
Gene ID:
Human(2903) Summary: N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate-gated ion channels. These receptors have been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of the key receptor subunit NMDAR1 (GRIN1) and 1 or more of the 4 NMDAR2 subunits: NMDAR2A (GRIN2A), NMDAR2B (GRIN2B), NMDAR2C (GRIN2C) and NMDAR2D (GRIN2D). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(14811) glutamate receptor, ionotropic, NMDA2A (epsilon 1)
Rat(24409) glutamate receptor, ionotropic, N-methyl D-aspartate 2A
chicken(427678) glutamate receptor, ionotropic, N-methyl D-aspartate 2A
dog(490012) glutamate receptor, ionotropic, N-methyl D-aspartate 2A
domestic cat(101086110) glutamate receptor, ionotropic, N-methyl D-aspartate 2A
sheep(101106989) glutamate receptor, ionotropic, N-methyl D-aspartate 2A
domestic guinea pig(100727265) glutamate receptor, ionotropic, N-methyl D-aspartate 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G9038 Anti-Glutamate Receptor NMDAR2A (NR2A) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
microarray, western blot pricing
M264 Anti-Glutamate Receptor NMDAR2A (NR2A) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, human, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB2100974 Anti-GRIN2A antibody produced in rabbit affinity isolated antibody mouse, horse, human, guinea pig
western blot pricing
SAB4501304 Anti-NMDAR2A, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry pricing
SAB5200897 Monoclonal Anti-Glun2A/Nr2A - Alkaline Phosphatase antibody produced in mouse clone S327-95, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200987 Monoclonal Anti-Glun2A/Nr2A - Alkaline Phosphatase antibody produced in mouse clone S327A-38, purified immunoglobulin human, rat, mouse
immunohistochemistry, western blot pricing
SAB5200898 Monoclonal Anti-Glun2A/Nr2A - Apc antibody produced in mouse clone S327-95, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200988 Monoclonal Anti-Glun2A/Nr2A - Apc antibody produced in mouse clone S327A-38, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200889 Monoclonal Anti-Glun2A/Nr2A - Atto 390 antibody produced in mouse clone S327-95, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200979 Monoclonal Anti-Glun2A/Nr2A - Atto 390 antibody produced in mouse clone S327A-38, purified immunoglobulin rat, human, mouse
immunohistochemistry, western blot pricing
SAB5200890 Monoclonal Anti-Glun2A/Nr2A - Atto 488 antibody produced in mouse clone S327-95, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200980 Monoclonal Anti-Glun2A/Nr2A - Atto 488 antibody produced in mouse clone S327A-38, purified immunoglobulin mouse, rat, human
immunohistochemistry, western blot pricing
SAB5200891 Monoclonal Anti-Glun2A/Nr2A - Atto 565 antibody produced in mouse clone S327-95, purified immunoglobulin rat, mouse, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200981 Monoclonal Anti-Glun2A/Nr2A - Atto 565 antibody produced in mouse clone S327A-38, purified immunoglobulin human, rat, mouse
immunohistochemistry, western blot pricing
SAB5200892 Monoclonal Anti-Glun2A/Nr2A - Atto 594 antibody produced in mouse clone S327-95, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200982 Monoclonal Anti-Glun2A/Nr2A - Atto 594 antibody produced in mouse clone S327A-38, purified immunoglobulin rat, human, mouse
immunohistochemistry, western blot pricing
SAB5200893 Monoclonal Anti-Glun2A/Nr2A - Atto 633 antibody produced in mouse clone S327-95, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200983 Monoclonal Anti-Glun2A/Nr2A - Atto 633 antibody produced in mouse clone S327A-38, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200894 Monoclonal Anti-Glun2A/Nr2A - Atto 655 antibody produced in mouse clone S327-95, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200984 Monoclonal Anti-Glun2A/Nr2A - Atto 655 antibody produced in mouse clone S327A-38, purified immunoglobulin human, rat, mouse
immunohistochemistry, western blot pricing
SAB5200895 Monoclonal Anti-Glun2A/Nr2A - Atto 680 antibody produced in mouse clone S327-95, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200985 Monoclonal Anti-Glun2A/Nr2A - Atto 680 antibody produced in mouse clone S327A-38, purified immunoglobulin rat, mouse, human
immunohistochemistry, western blot pricing
SAB5200896 Monoclonal Anti-Glun2A/Nr2A - Atto 700 antibody produced in mouse clone S327-95, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200986 Monoclonal Anti-Glun2A/Nr2A - Atto 700 antibody produced in mouse clone S327A-38, purified immunoglobulin mouse, human, rat
immunohistochemistry, western blot pricing
SAB5200899 Monoclonal Anti-Glun2A/Nr2A - Biotin antibody produced in mouse clone S327-95, purified immunoglobulin human, mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200989 Monoclonal Anti-Glun2A/Nr2A - Biotin antibody produced in mouse clone S327A-38, purified immunoglobulin human, rat, mouse
immunohistochemistry, western blot pricing
SAB5200900 Monoclonal Anti-Glun2A/Nr2A - Fitc antibody produced in mouse clone S327-95, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200990 Monoclonal Anti-Glun2A/Nr2A - Fitc antibody produced in mouse clone S327A-38, purified immunoglobulin rat, mouse, human
immunohistochemistry, western blot pricing
SAB5200901 Monoclonal Anti-Glun2A/Nr2A - Hrp antibody produced in mouse clone S327-95, purified immunoglobulin mouse, rat, human
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200991 Monoclonal Anti-Glun2A/Nr2A - Hrp antibody produced in mouse clone S327A-38, purified immunoglobulin mouse, human, rat
immunohistochemistry, western blot pricing
SAB5200902 Monoclonal Anti-Glun2A/Nr2A - Pe/Atto 594 antibody produced in mouse clone S327-95, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200992 Monoclonal Anti-Glun2A/Nr2A - Pe/Atto 594 antibody produced in mouse clone S327A-38, purified immunoglobulin rat, mouse, human
immunohistochemistry, western blot pricing
SAB5200903 Monoclonal Anti-Glun2A/Nr2A - Percp antibody produced in mouse clone S327-95, purified immunoglobulin mouse, human, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200993 Monoclonal Anti-Glun2A/Nr2A - Percp antibody produced in mouse clone S327A-38, purified immunoglobulin mouse, human, rat
immunohistochemistry, western blot pricing
SAB5200904 Monoclonal Anti-Glun2A/Nr2A - Rpe antibody produced in mouse clone S327-95, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200994 Monoclonal Anti-Glun2A/Nr2A - Rpe antibody produced in mouse clone S327A-38, purified immunoglobulin human, mouse, rat
immunohistochemistry, western blot pricing
SAB5200905 Monoclonal Anti-Glun2A/Nr2A - Streptavidin antibody produced in mouse clone S327-95, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200995 Monoclonal Anti-Glun2A/Nr2A - Streptavidin antibody produced in mouse clone S327A-38, purified immunoglobulin human, rat, mouse
immunohistochemistry, western blot pricing
SAB5200888 Monoclonal Anti-Glun2A/Nr2A antibody produced in mouse clone S327-95, purified immunoglobulin human, rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5200978 Monoclonal Anti-Glun2A/Nr2A antibody produced in mouse clone S327A-38, purified immunoglobulin rat, human, mouse
immunohistochemistry, western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
275875 4-Aminopyridine ≥99% mouse, rat pricing
A78403 4-Aminopyridine 98% mouse, rat pricing
36687 4-Aminopyridine PESTANAL®, analytical standard mouse, rat pricing
561479 4-Aminopiperidine rat pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
180378 1-Adamantanemethylamine 98% human pricing
138576 1-Adamantylamine 97% human pricing
A0384 Arcaine sulfate salt human pricing
D2531 Dextromethorphan hydrobromide monohydrate ≥99% (TLC) human pricing
D127 Dextrorphan tartrate powder human pricing
I2892 Ifenprodil (+)-tartrate salt human pricing
M107 (+)-MK-801 hydrogen maleate powder human, mouse, rat pricing
A0326 (S)-AMPA ≥98% human, mouse, rat pricing
43029 1,3-Diphenylguanidine analytical standard (for titrimetry) human, mouse, rat pricing
D207756 1,3-Diphenylguanidine 97% human, mouse, rat pricing
D138 5,7-Dichlorokynurenic acid monohydrate solid, ≥98% (HPLC) human, mouse, rat pricing
D0540 DNQX ≥98% (TLC) human, mouse, rat pricing
K0250 Kainic acid monohydrate ≥99% (TLC) human, mouse, rat pricing
N5501 Nω-Nitro-L-arginine ≥98% (TLC) human, mouse, rat pricing
N179 NS 102 solid human, mouse, rat pricing
A1910 (±)-2-Amino-4-phosphonobutyric acid solid human, rat pricing
C104 (±)-CPP solid human, rat pricing
G137 (2S,4R)-4-Methylglutamic acid solid human, rat pricing
324817 (Aminomethyl)phosphonic acid 99% human, rat pricing
MET12133A (Aminomethyl)phosphonic acid analytical standard human, rat pricing
D133 6,7-Dichloroquinoxaline-2,3-dione human, rat pricing
A7845 ATPO solid human, rat pricing
UC205 Dextrorphan human, rat pricing
A5157 DL-2-Amino-7-phosphonoheptanoic acid ~95% human, rat pricing
G120 GYKI 52895 solid human, rat pricing
I5109 Indole-2-carboxylic acid 98% human, rat pricing
K3375 Kynurenic acid ≥98% human, rat pricing
A5474 L-Aspartic acid PharmaGrade, Ajinomoto, EP, JP, USP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human, rat pricing
A9256 L-Aspartic acid reagent grade, ≥98% (HPLC) human, rat pricing
A8949 L-Aspartic acid BioXtra, ≥99% (HPLC) human, rat pricing
A7219 L-Aspartic acid from non-animal source, meets EP, USP testing specifications, suitable for cell culture, 98.5-101.0% human, rat pricing
A4534 L-Aspartic acid BioReagent, suitable for cell culture, suitable for insect cell culture human, rat pricing
11189 L-Aspartic acid BioUltra, ≥99.5% (T) human, rat pricing
A9506 L-Aspartic acid hemimagnesium salt hydrate ≥98% (TLC) human, rat pricing
A6683 L-Aspartic acid sodium salt monohydrate ≥98% (TLC) human, rat pricing
G5667 L-Glutamic acid PharmaGrade, Ajinomoto, EP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture human, rat pricing
W328502 L-Glutamic acid 99%, FCC human, rat pricing
G8415 L-Glutamic acid from non-animal source, meets EP testing specifications, suitable for cell culture, 98.5-100.5% human, rat pricing
49449 L-Glutamic acid BioUltra, ≥99.5% (NT) human, rat pricing
G1251 L-Glutamic acid ReagentPlus®, ≥99% (HPLC) human, rat pricing
09581 L-Glutamic acid tested according to Ph.Eur. human, rat pricing
L0258 L-701,324 ≥98% (HPLC), solid human, rat pricing
S4264 Spermine BioReagent, amorphous semi-solid, suitable for cell culture human, rat pricing
S3256 Spermine ≥97% human, rat pricing
85588 Spermine dihydrate BioUltra, ≥99.5% (GC) human, rat pricing
A8054 D(−)-2-Amino-5-phosphonopentanoic acid NMDA receptor antagonist mouse, rat pricing
A6816 (±)-AMPA solid rat pricing
144789 2,3-Dihydroxyquinoxaline 98% rat pricing
P63204 2,3-Pyridinedicarboxylic acid 99% rat pricing
305081 4-Methoxy-2-quinolinecarboxylic acid 95% rat pricing
657239 6-Nitro-2,3-dihydroxyquinoxaline 96% rat pricing
C127 CNQX ≥98% (HPLC), solid rat pricing
A7400 D-2-Aminoadipic acid rat pricing
A5282 DL-2-Amino-5-phosphonopentanoic acid solid rat pricing
A6553 DL-2-Amino-5-phosphonovaleric acid lithium salt ~95% rat pricing
G5417 Glycine PharmaGrade, Ajinomoto, EP, JP, USP, manufactured under appropriate GMP controls for Pharma or Biopharmaceutical production, suitable for cell culture rat pricing
410225 Glycine ACS reagent, ≥98.5% rat pricing
G7126 Glycine ReagentPlus®, ≥99% (HPLC) rat pricing
50046 Glycine BioUltra, for molecular biology, ≥99.0% (NT) rat pricing
G8898 Glycine for electrophoresis, ≥99% rat pricing
G7403 Glycine BioXtra, ≥99% (titration) rat pricing
G8790 Glycine from non-animal source, meets EP, JP, USP testing specifications, suitable for cell culture, ≥98.5% rat pricing
33226 Glycine puriss. p.a., Reag. Ph. Eur., buffer substance, 99.7-101% (calc. to the dried substance) rat pricing
15527 Glycine meets analytical specification of Ph. Eur., BP, USP, 99-101% (based on anhydrous substance) rat pricing
W328707 Glycine 99%, FCC rat pricing
P7575 L-trans-Pyrrolidine-2,4-dicarboxylic acid ≥98% rat pricing
M3387 N-Methyl-L-aspartic acid rat pricing
P8791 Polyglycine mol wt 500-5,000 rat pricing
Q2128 Quisqualic acid powder rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
P0547 Pentamidine isethionate salt powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000833 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000833 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000833 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008170 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008170 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008170 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
AB1555 Anti-NMDAR2A Antibody This Anti-NMDAR2A Antibody is validated for use in IP, WB for the detection of NMDAR2A. pricing
AB1555P Anti-NMDAR2A Antibody Anti-NMDAR2A Antibody is an antibody against NMDAR2A for use in IH, IP & WB. pricing
MAB5216 Anti-NMDAR2A Antibody Anti-NMDAR2A Antibody detects level of NMDAR2A & has been published & validated for use in IH(P), IC, IH & WB. pricing
MAB5530 Anti-NMDAR2A Antibody Detect NMDAR2A using this Anti-NMDAR2A Antibody validated for use in WB. pricing
MAB5572 Anti-NMDAR2A Antibody Anti-NMDAR2A Antibody detects level of NMDAR2A & has been published & validated for use in WB. pricing
AB1548W Anti-NMDAR2A&B Antibody Detect NMDAR2A&B using this Anti-NMDAR2A&B Antibody validated for use in WB. pricing
AB1548 Anti-NMDAR2A&B Antibody, pan Anti-NMDAR2A&B Antibody, pan detects level of NMDAR2A&B & has been published & validated for use in IH(P), IC, IH, IP & WB. pricing
07-632 Anti-NR2A Antibody Detect NR2A using this Anti-NR2A Antibody validated for use in IP & WB. pricing
AB10531 Anti-NR2A Antibody Anti-NR2A Antibody detects level of NR2A & has been published & validated for use in WB. pricing
04-901 Anti-NR2A Antibody, clone A12W, rabbit monoclonal Anti-NR2A Antibody, clone A12W is an antibody against NR2A for use in WB. pricing
05-901R Anti-NR2A Antibody, clone A12W, rabbit monoclonal This Anti-NR2A Antibody, clone A12W is validated for use in WB for the detection of NR2A. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000833 Rosetta Predictions human pricing
NM_012573 Rosetta Predictions rat pricing
XM_579337 Rosetta Predictions rat pricing
NM_008170 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044425 predicted 3254
2 SASI_Hs01_00044426 predicted 3438
3 SASI_Hs01_00044428 predicted 3186
4 SASI_Hs01_00044430 predicted 2187
5 SASI_Hs01_00044431 predicted 2583
6 SASI_Hs01_00044432 predicted 4126
7 SASI_Hs01_00044433 predicted 3221
8 SASI_Hs02_00303326 predicted 4191
9 SASI_Hs02_00303327 predicted 3202
10 SASI_Hs02_00303328 predicted 4215
11 SASI_Hs01_00044427 predicted 4507
12 SASI_Hs01_00044429 predicted 3655
13 SASI_Hs01_00044434 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012573 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259690 predicted 1761
2 SASI_Rn02_00259691 predicted 456
3 SASI_Rn02_00259692 predicted 3716
4 SASI_Rn02_00259693 predicted 3008
5 SASI_Rn02_00259694 predicted 871
6 SASI_Rn02_00259695 predicted 2325
7 SASI_Rn02_00259696 predicted 3273
8 SASI_Rn02_00259697 predicted 1606
9 SASI_Rn02_00259698 predicted 4126
10 SASI_Rn02_00259699 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126791 predicted 2977
2 SASI_Rn01_00126792 predicted 1625
3 SASI_Rn01_00126793 predicted 311
4 SASI_Rn01_00126794 predicted 2867
5 SASI_Rn01_00126795 predicted 3134
6 SASI_Rn01_00126796 predicted 1473
7 SASI_Rn01_00126797 predicted 3418
8 SASI_Rn01_00126798 predicted 889
9 SASI_Rn01_00126799 predicted 2999
10 SASI_Rn01_00126800 predicted 3342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313288 predicted 2102
2 SASI_Mm01_00035988 predicted 3291
3 SASI_Mm01_00035989 predicted 4284
4 SASI_Mm02_00313289 predicted 4058
5 SASI_Mm01_00035990 predicted 230
6 SASI_Mm01_00035991 predicted 2785
7 SASI_Mm01_00035992 predicted 3056
8 SASI_Mm01_00035993 predicted 2433
9 SASI_Mm02_00313290 predicted 3592
10 SASI_Mm02_00313291 predicted 748
11 SASI_Mm01_00035987 predicted 2899
12 SASI_Mm01_00035994 predicted 2600
13 SASI_Mm01_00035995 predicted 1879
14 SASI_Mm01_00035996 predicted 4189
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000833
VALIDATED
GRIN2A MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl D-aspartate 2A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000833.3-5018s21c1
Sequence:CCGGCCAATGGTGATGTTATGATTTCTCGAGAAATCATAACATCACCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000833.3-1725s21c1
Sequence:CCGGAGTTTACTTACGACCTCTATCCTCGAGGATAGAGGTCGTAAGTAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000833.3-3488s21c1
Sequence:CCGGGACATTTCAGAAACGTCAAATCTCGAGATTTGACGTTTCTGAAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000833.3-3651s21c1
Sequence:CCGGGAGACAAGATCTACACTATAGCTCGAGCTATAGTGTAGATCTTGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000833.3-4427s21c1
Sequence:CCGGGATGACCAACGCTTGGTTATTCTCGAGAATAACCAAGCGTTGGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000833.2-4171s1c1
Sequence:CCGGCCGTCAGCATTCCTACGATAACTCGAGTTATCGTAGGAATGCTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_000833.2-2379s1c1
Sequence:CCGGCGGAGAGAAACATTCGGAATACTCGAGTATTCCGAATGTTTCTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000833.2-1228s1c1
Sequence:CCGGGCTGGAGAAGTTCTCCTACATCTCGAGATGTAGGAGAACTTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_000833.2-3218s1c1
Sequence:CCGGCGGCAGAAGGATAACCTCAATCTCGAGATTGAGGTTATCCTTCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000833.2-784s1c1
Sequence:CCGGGCTGAAGATCATGCAGGATTACTCGAGTAATCCTGCATGATCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000833
VALIDATED
GRIN2A MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl D-aspartate 2A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000833.3-5018s21c1
Sequence:CCGGCCAATGGTGATGTTATGATTTCTCGAGAAATCATAACATCACCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000833.3-1725s21c1
Sequence:CCGGAGTTTACTTACGACCTCTATCCTCGAGGATAGAGGTCGTAAGTAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000833.3-3488s21c1
Sequence:CCGGGACATTTCAGAAACGTCAAATCTCGAGATTTGACGTTTCTGAAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000833.3-3651s21c1
Sequence:CCGGGAGACAAGATCTACACTATAGCTCGAGCTATAGTGTAGATCTTGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000833.3-4427s21c1
Sequence:CCGGGATGACCAACGCTTGGTTATTCTCGAGAATAACCAAGCGTTGGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000833.2-4171s1c1
Sequence:CCGGCCGTCAGCATTCCTACGATAACTCGAGTTATCGTAGGAATGCTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_000833.2-2379s1c1
Sequence:CCGGCGGAGAGAAACATTCGGAATACTCGAGTATTCCGAATGTTTCTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000833.2-1228s1c1
Sequence:CCGGGCTGGAGAAGTTCTCCTACATCTCGAGATGTAGGAGAACTTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_000833.2-3218s1c1
Sequence:CCGGCGGCAGAAGGATAACCTCAATCTCGAGATTGAGGTTATCCTTCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000833.2-784s1c1
Sequence:CCGGGCTGAAGATCATGCAGGATTACTCGAGTAATCCTGCATGATCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000833
VALIDATED
GRIN2A MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl D-aspartate 2A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433590    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000833.3-5018s21c1
Sequence:CCGGCCAATGGTGATGTTATGATTTCTCGAGAAATCATAACATCACCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000833.3-1725s21c1
Sequence:CCGGAGTTTACTTACGACCTCTATCCTCGAGGATAGAGGTCGTAAGTAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000833.3-3488s21c1
Sequence:CCGGGACATTTCAGAAACGTCAAATCTCGAGATTTGACGTTTCTGAAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000833.3-3651s21c1
Sequence:CCGGGAGACAAGATCTACACTATAGCTCGAGCTATAGTGTAGATCTTGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000833.3-4427s21c1
Sequence:CCGGGATGACCAACGCTTGGTTATTCTCGAGAATAACCAAGCGTTGGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000833.2-4171s1c1
Sequence:CCGGCCGTCAGCATTCCTACGATAACTCGAGTTATCGTAGGAATGCTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_000833.2-2379s1c1
Sequence:CCGGCGGAGAGAAACATTCGGAATACTCGAGTATTCCGAATGTTTCTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000833.2-1228s1c1
Sequence:CCGGGCTGGAGAAGTTCTCCTACATCTCGAGATGTAGGAGAACTTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_000833.2-3218s1c1
Sequence:CCGGCGGCAGAAGGATAACCTCAATCTCGAGATTGAGGTTATCCTTCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000833.2-784s1c1
Sequence:CCGGGCTGAAGATCATGCAGGATTACTCGAGTAATCCTGCATGATCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008170
GRIN2A MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, ionotropic, N-methyl D-aspartate 2A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-3535s1c1
Sequence:CCGGCCCAACAATGACCAGTATAAACTCGAGTTTATACTGGTCATTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-2103s1c1
Sequence:CCGGGCACCAGTACATGACCAAATTCTCGAGAATTTGGTCATGTACTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-747s1c1
Sequence:CCGGCGGCTACGATTTCTTCTGGATCTCGAGATCCAGAAGAAATCGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-4253s1c1
Sequence:CCGGGCCACAGTGATGTGTATATTTCTCGAGAAATATACACATCACTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-4074s1c1
Sequence:CCGGGCCAGACCATACCTCTGATAACTCGAGTTATCAGAGGTATGGTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008170
GRIN2A MISSION shRNA shRNA Plasmid DNA
glutamate receptor, ionotropic, N-methyl D-aspartate 2A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-3535s1c1
Sequence:CCGGCCCAACAATGACCAGTATAAACTCGAGTTTATACTGGTCATTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-2103s1c1
Sequence:CCGGGCACCAGTACATGACCAAATTCTCGAGAATTTGGTCATGTACTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-747s1c1
Sequence:CCGGCGGCTACGATTTCTTCTGGATCTCGAGATCCAGAAGAAATCGTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-4253s1c1
Sequence:CCGGGCCACAGTGATGTGTATATTTCTCGAGAAATATACACATCACTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000100266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-4074s1c1
Sequence:CCGGGCCAGACCATACCTCTGATAACTCGAGTTATCAGAGGTATGGTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008170
GRIN2A MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, ionotropic, N-methyl D-aspartate 2A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-3535s1c1
Sequence:CCGGCCCAACAATGACCAGTATAAACTCGAGTTTATACTGGTCATTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-2103s1c1
Sequence:CCGGGCACCAGTACATGACCAAATTCTCGAGAATTTGGTCATGTACTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-747s1c1
Sequence:CCGGCGGCTACGATTTCTTCTGGATCTCGAGATCCAGAAGAAATCGTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-4253s1c1
Sequence:CCGGGCCACAGTGATGTGTATATTTCTCGAGAAATATACACATCACTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000100266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008170.2-4074s1c1
Sequence:CCGGGCCAGACCATACCTCTGATAACTCGAGTTATCAGAGGTATGGTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)