EMAIL THIS PAGE TO A FRIEND

GRLF1

15 Gene Product Result for
Species: Mouse Grlf1(232906), Domestic Rabbit GRLF1(100356673)
Gene ID:
Domestic Rabbit(100356673) Rho GTPase activating protein 35
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
R2654 Anti-p190 RhoGAP (GK-18) antibody produced in rabbit ~0.8 mg/mL, affinity isolated antibody, buffered aqueous solution canine, mouse, human
immunoprecipitation (IP), western blot pricing
R3150 Monoclonal Anti-RhoGAP (p190) antibody produced in mouse clone D2D6, purified immunoglobulin, buffered aqueous solution rat, mouse, monkey, human
immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU066431 MISSION® esiRNA targeting mouse Grlf1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173236 predicted 2727
2 SASI_Mm01_00173237 predicted 3068
3 SASI_Mm01_00173238 predicted 1705
4 SASI_Mm01_00173239 predicted 1491
5 SASI_Mm01_00173240 predicted 1230
6 SASI_Mm01_00173242 predicted 995
7 SASI_Mm01_00173243 predicted 4368
8 SASI_Mm02_00344570 predicted 4548
9 SASI_Mm01_00173244 predicted 2778
10 SASI_Mm02_00344571 predicted 4311
11 SASI_Mm01_00173241 predicted 1763
12 SASI_Mm01_00173245 predicted 2492
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172739
VALIDATED
GRLF1 MISSION shRNA Bacterial Glycerol Stock
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172739.1-674s1c1
Sequence:CCGGCCACTGGGTAAACAAGTCCTTCTCGAGAAGGACTTGTTTACCCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-3702s21c1
Sequence:CCGGTTTCGGGAAGATGCGACATTGCTCGAGCAATGTCGCATCTTCCCGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-2989s21c1
Sequence:CCGGTGGACTCCAAGCGCAACTTAACTCGAGTTAAGTTGCGCTTGGAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-1324s21c1
Sequence:CCGGAGGGCGTTGAGCGGTACATTACTCGAGTAATGTACCGCTCAACGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172739.1-617s1c1
Sequence:CCGGGAAAGAAACCACAGCAAGAAACTCGAGTTTCTTGCTGTGGTTTCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-2429s21c1
Sequence:CCGGCTTGATCAGTTCTCGCTTTATCTCGAGATAAAGCGAGAACTGATCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-7668s21c1
Sequence:CCGGCTAAGGCTAGAGGCACTATTACTCGAGTAATAGTGCCTCTAGCCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172739.4-2429s1c1
Sequence:CCGGCTTGATCAGTTCTCGCTTTATCTCGAGATAAAGCGAGAACTGATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172739.4-4361s1c1
Sequence:CCGGGAATATCCTTCGAAGTCTAAGCTCGAGCTTAGACTTCGAAGGATATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172739
VALIDATED
GRLF1 MISSION shRNA shRNA Plasmid DNA
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172739.1-674s1c1
Sequence:CCGGCCACTGGGTAAACAAGTCCTTCTCGAGAAGGACTTGTTTACCCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-3702s21c1
Sequence:CCGGTTTCGGGAAGATGCGACATTGCTCGAGCAATGTCGCATCTTCCCGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-2989s21c1
Sequence:CCGGTGGACTCCAAGCGCAACTTAACTCGAGTTAAGTTGCGCTTGGAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-1324s21c1
Sequence:CCGGAGGGCGTTGAGCGGTACATTACTCGAGTAATGTACCGCTCAACGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172739.1-617s1c1
Sequence:CCGGGAAAGAAACCACAGCAAGAAACTCGAGTTTCTTGCTGTGGTTTCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-2429s21c1
Sequence:CCGGCTTGATCAGTTCTCGCTTTATCTCGAGATAAAGCGAGAACTGATCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-7668s21c1
Sequence:CCGGCTAAGGCTAGAGGCACTATTACTCGAGTAATAGTGCCTCTAGCCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172739.4-2429s1c1
Sequence:CCGGCTTGATCAGTTCTCGCTTTATCTCGAGATAAAGCGAGAACTGATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172739.4-4361s1c1
Sequence:CCGGGAATATCCTTCGAAGTCTAAGCTCGAGCTTAGACTTCGAAGGATATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172739
VALIDATED
GRLF1 MISSION shRNA Lentiviral Transduction Particles
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172739.1-674s1c1
Sequence:CCGGCCACTGGGTAAACAAGTCCTTCTCGAGAAGGACTTGTTTACCCAGTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000243511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-3702s21c1
Sequence:CCGGTTTCGGGAAGATGCGACATTGCTCGAGCAATGTCGCATCTTCCCGAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000243515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-2989s21c1
Sequence:CCGGTGGACTCCAAGCGCAACTTAACTCGAGTTAAGTTGCGCTTGGAGTCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000243512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-1324s21c1
Sequence:CCGGAGGGCGTTGAGCGGTACATTACTCGAGTAATGTACCGCTCAACGCCCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000174933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172739.1-617s1c1
Sequence:CCGGGAAAGAAACCACAGCAAGAAACTCGAGTTTCTTGCTGTGGTTTCTTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000243514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-2429s21c1
Sequence:CCGGCTTGATCAGTTCTCGCTTTATCTCGAGATAAAGCGAGAACTGATCAAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000243513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172739.4-7668s21c1
Sequence:CCGGCTAAGGCTAGAGGCACTATTACTCGAGTAATAGTGCCTCTAGCCTTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172739.4-2429s1c1
Sequence:CCGGCTTGATCAGTTCTCGCTTTATCTCGAGATAAAGCGAGAACTGATCAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000216769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172739.4-4361s1c1
Sequence:CCGGGAATATCCTTCGAAGTCTAAGCTCGAGCTTAGACTTCGAAGGATATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???