EMAIL THIS PAGE TO A FRIEND

GRM5

glutamate receptor, metabotropic 5

189 Gene Product Result for
Synonyms: GPRC1E MGLUR5 mGlu5
UniProtKB ID: P41594
Gene ID:
Human(2915) Summary: L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Mouse(108071) glutamate receptor, metabotropic 5
Rat(24418) glutamate receptor, metabotropic 5
chicken(373933) glutamate receptor, metabotropic 5
cow(100336861) glutamate receptor, metabotropic 5
domestic cat(101091895) glutamate receptor, metabotropic 5
dog(485146) glutamate receptor, metabotropic 5
domestic guinea pig(100714109) glutamate receptor, metabotropic 5
naked mole-rat(101696979) glutamate receptor, metabotropic 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501323 Anti-GRM5, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, western blot pricing
SAB1306012 ANTI-METABOTROPIC GLUTAMATE RECEPTOR 5 (GPRC1E) (C-TERM T1003) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
HPA014096 Anti-MGLUR5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
WH0002915M1 Monoclonal Anti-GRM5 antibody produced in mouse clone 1B3, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
SAB1403885 Monoclonal Anti-GRM5 antibody produced in mouse clone 3E7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5200501 Monoclonal Anti-Mglur1/5 - Alkaline Phosphatase antibody produced in mouse clone S75-33, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200717 Monoclonal Anti-Mglur1/5 - Alkaline Phosphatase antibody produced in mouse clone S75-33, purified immunoglobulin rat, human, mouse
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200502 Monoclonal Anti-Mglur1/5 - Apc antibody produced in mouse clone S75-33, purified immunoglobulin mouse, rat, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200718 Monoclonal Anti-Mglur1/5 - Apc antibody produced in mouse clone S75-33, purified immunoglobulin mouse, human, rat
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200493 Monoclonal Anti-Mglur1/5 - Atto 390 antibody produced in mouse clone S75-33, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200709 Monoclonal Anti-Mglur1/5 - Atto 390 antibody produced in mouse clone S75-33, purified immunoglobulin rat, mouse, human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200494 Monoclonal Anti-Mglur1/5 - Atto 488 antibody produced in mouse clone S75-33, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200710 Monoclonal Anti-Mglur1/5 - Atto 488 antibody produced in mouse clone S75-33, purified immunoglobulin mouse, rat, human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200495 Monoclonal Anti-Mglur1/5 - Atto 565 antibody produced in mouse clone S75-33, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200711 Monoclonal Anti-Mglur1/5 - Atto 565 antibody produced in mouse clone S75-33, purified immunoglobulin mouse, rat, human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200496 Monoclonal Anti-Mglur1/5 - Atto 594 antibody produced in mouse clone S75-33, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200712 Monoclonal Anti-Mglur1/5 - Atto 594 antibody produced in mouse clone S75-33, purified immunoglobulin human, mouse, rat
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200497 Monoclonal Anti-Mglur1/5 - Atto 633 antibody produced in mouse clone S75-33, purified immunoglobulin mouse, human, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200713 Monoclonal Anti-Mglur1/5 - Atto 633 antibody produced in mouse clone S75-33, purified immunoglobulin human, rat, mouse
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200498 Monoclonal Anti-Mglur1/5 - Atto 655 antibody produced in mouse clone S75-33, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200714 Monoclonal Anti-Mglur1/5 - Atto 655 antibody produced in mouse clone S75-33, purified immunoglobulin human, rat, mouse
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200499 Monoclonal Anti-Mglur1/5 - Atto 680 antibody produced in mouse clone S75-33, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200715 Monoclonal Anti-Mglur1/5 - Atto 680 antibody produced in mouse clone S75-33, purified immunoglobulin rat, human, mouse
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200500 Monoclonal Anti-Mglur1/5 - Atto 700 antibody produced in mouse clone S75-33, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200716 Monoclonal Anti-Mglur1/5 - Atto 700 antibody produced in mouse clone S75-33, purified immunoglobulin mouse, rat, human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200503 Monoclonal Anti-Mglur1/5 - Biotin antibody produced in mouse clone S75-33, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200719 Monoclonal Anti-Mglur1/5 - Biotin antibody produced in mouse clone S75-33, purified immunoglobulin mouse, rat, human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200504 Monoclonal Anti-Mglur1/5 - Fitc antibody produced in mouse clone S75-33, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200720 Monoclonal Anti-Mglur1/5 - Fitc antibody produced in mouse clone S75-33, purified immunoglobulin human, rat, mouse
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200505 Monoclonal Anti-Mglur1/5 - Hrp antibody produced in mouse clone S75-33, purified immunoglobulin rat, mouse, human
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200721 Monoclonal Anti-Mglur1/5 - Hrp antibody produced in mouse clone S75-33, purified immunoglobulin rat, human, mouse
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200506 Monoclonal Anti-Mglur1/5 - Pe/Atto 594 antibody produced in mouse clone S75-33, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200722 Monoclonal Anti-Mglur1/5 - Pe/Atto 594 antibody produced in mouse clone S75-33, purified immunoglobulin rat, mouse, human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200507 Monoclonal Anti-Mglur1/5 - Percp antibody produced in mouse clone S75-33, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200723 Monoclonal Anti-Mglur1/5 - Percp antibody produced in mouse clone S75-33, purified immunoglobulin rat, mouse, human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200508 Monoclonal Anti-Mglur1/5 - Rpe antibody produced in mouse clone S75-33, purified immunoglobulin human, rat, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200724 Monoclonal Anti-Mglur1/5 - Rpe antibody produced in mouse clone S75-33, purified immunoglobulin human, mouse, rat
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200509 Monoclonal Anti-Mglur1/5 - Streptavidin antibody produced in mouse clone S75-33, purified immunoglobulin rat, human, mouse
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200725 Monoclonal Anti-Mglur1/5 - Streptavidin antibody produced in mouse clone S75-33, purified immunoglobulin human, rat, mouse
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200492 Monoclonal Anti-Mglur1/5 antibody produced in mouse clone S75-33, purified immunoglobulin human, mouse, rat
immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5200708 Monoclonal Anti-Mglur1/5 antibody produced in mouse clone S75-33, purified immunoglobulin human, rat, mouse
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
A9950 Aniracetam ≥98% human, rat pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
D0943 DFB ≥98% (HPLC), solid human pricing
09581 L-Glutamic acid tested according to Ph.Eur. human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000842 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000842 Rosetta Predictions human pricing
NM_017012 Rosetta Predictions rat pricing
NM_001081414 Rosetta Predictions mouse pricing
XM_985499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108965 predicted 1842
2 SASI_Hs02_00303341 predicted 2424
3 SASI_Hs01_00108967 predicted 1497
4 SASI_Hs01_00108968 predicted 2493
5 SASI_Hs01_00108970 predicted 2510
6 SASI_Hs01_00108971 predicted 2636
7 SASI_Hs01_00108972 predicted 2662
8 SASI_Hs02_00303342 predicted 2296
9 SASI_Hs01_00108973 predicted 2354
10 SASI_Hs02_00303343 predicted 2595
11 SASI_Hs01_00108966 predicted 1769
12 SASI_Hs01_00108969 predicted 775
13 SASI_Hs01_00108974 predicted 2135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059765 predicted 2305
2 SASI_Rn01_00059766 predicted 1482
3 SASI_Rn02_00261176 predicted 1024
4 SASI_Rn01_00059767 predicted 2410
5 SASI_Rn01_00059768 predicted 884
6 SASI_Rn01_00059770 predicted 1654
7 SASI_Rn01_00059771 predicted 1834
8 SASI_Rn01_00059772 predicted 1466
9 SASI_Rn01_00059773 predicted 2496
10 SASI_Rn01_00059774 predicted 697
11 SASI_Rn01_00059769 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298151 predicted 2201
2 SASI_Mm02_00298152 predicted 1383
3 SASI_Mm02_00298153 predicted 2244
4 SASI_Mm02_00298154 predicted 712
5 SASI_Mm02_00298155 predicted 486
6 SASI_Mm02_00298156 predicted 1674
7 SASI_Mm02_00298157 predicted 1299
8 SASI_Mm02_00298158 predicted 2328
9 SASI_Mm02_00298159 predicted 1287
10 SASI_Mm02_00298160 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_985499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214630 predicted 2204
2 SASI_Mm01_00214631 predicted 555
3 SASI_Mm01_00214632 predicted 1394
4 SASI_Mm01_00214633 predicted 2245
5 SASI_Mm01_00214634 predicted 720
6 SASI_Mm01_00214635 predicted 1680
7 SASI_Mm01_00214636 predicted 1309
8 SASI_Mm01_00214637 predicted 2338
9 SASI_Mm01_00214638 predicted 1293
10 SASI_Mm01_00214639 predicted 541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000842
GRM5 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000842.3-1564s21c1
Sequence:CCGGTTGTGATCAACGCCATCTATTCTCGAGAATAGATGGCGTTGATCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000842.3-4075s21c1
Sequence:CCGGACGAAGAAACCGACGACAAATCTCGAGATTTGTCGTCGGTTTCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000842.3-3843s21c1
Sequence:CCGGATCCCGTCGTCTCCCAAATATCTCGAGATATTTGGGAGACGACGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000842.3-4247s21c1
Sequence:CCGGGAGGGTGAAGAGCATAGTTAACTCGAGTTAACTATGCTCTTCACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000842.1-3740s1c1
Sequence:CCGGCCGTGTTCACACACACACAATCTCGAGATTGTGTGTGTGTGAACACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000842.1-2462s1c1
Sequence:CCGGCCAAGTATATCGCCTTCACAACTCGAGTTGTGAAGGCGATATACTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000842.1-1144s1c1
Sequence:CCGGCCCGATGTCAAGTGGTTTGATCTCGAGATCAAACCACTTGACATCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000842.1-1357s1c1
Sequence:CCGGGCCATCTATTCGATGGCCTATCTCGAGATAGGCCATCGAATAGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000842.1-1927s1c1
Sequence:CCGGGCCACCCTGTTTGTTACTGTACTCGAGTACAGTAACAAACAGGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000842
GRM5 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000842.3-1564s21c1
Sequence:CCGGTTGTGATCAACGCCATCTATTCTCGAGAATAGATGGCGTTGATCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000842.3-4075s21c1
Sequence:CCGGACGAAGAAACCGACGACAAATCTCGAGATTTGTCGTCGGTTTCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000842.3-3843s21c1
Sequence:CCGGATCCCGTCGTCTCCCAAATATCTCGAGATATTTGGGAGACGACGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000842.3-4247s21c1
Sequence:CCGGGAGGGTGAAGAGCATAGTTAACTCGAGTTAACTATGCTCTTCACCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000842.1-3740s1c1
Sequence:CCGGCCGTGTTCACACACACACAATCTCGAGATTGTGTGTGTGTGAACACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000842.1-2462s1c1
Sequence:CCGGCCAAGTATATCGCCTTCACAACTCGAGTTGTGAAGGCGATATACTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000842.1-1144s1c1
Sequence:CCGGCCCGATGTCAAGTGGTTTGATCTCGAGATCAAACCACTTGACATCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000842.1-1357s1c1
Sequence:CCGGGCCATCTATTCGATGGCCTATCTCGAGATAGGCCATCGAATAGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000842.1-1927s1c1
Sequence:CCGGGCCACCCTGTTTGTTACTGTACTCGAGTACAGTAACAAACAGGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000842
GRM5 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000842.3-1564s21c1
Sequence:CCGGTTGTGATCAACGCCATCTATTCTCGAGAATAGATGGCGTTGATCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000842.3-4075s21c1
Sequence:CCGGACGAAGAAACCGACGACAAATCTCGAGATTTGTCGTCGGTTTCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000842.3-3843s21c1
Sequence:CCGGATCCCGTCGTCTCCCAAATATCTCGAGATATTTGGGAGACGACGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000842.3-4247s21c1
Sequence:CCGGGAGGGTGAAGAGCATAGTTAACTCGAGTTAACTATGCTCTTCACCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000842.1-3740s1c1
Sequence:CCGGCCGTGTTCACACACACACAATCTCGAGATTGTGTGTGTGTGAACACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000842.1-2462s1c1
Sequence:CCGGCCAAGTATATCGCCTTCACAACTCGAGTTGTGAAGGCGATATACTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000842.1-1144s1c1
Sequence:CCGGCCCGATGTCAAGTGGTTTGATCTCGAGATCAAACCACTTGACATCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000842.1-1357s1c1
Sequence:CCGGGCCATCTATTCGATGGCCTATCTCGAGATAGGCCATCGAATAGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000842.1-1927s1c1
Sequence:CCGGGCCACCCTGTTTGTTACTGTACTCGAGTACAGTAACAAACAGGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081414
GRM5 MISSION shRNA Bacterial Glycerol Stock
glutamate receptor, metabotropic 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081414.1-324s21c1
Sequence:CCGGATACCTTGGAAAGGATCAATTCTCGAGAATTGATCCTTTCCAAGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081414.1-2238s21c1
Sequence:CCGGTCATGGAGCCTCCGGATATAACTCGAGTTATATCCGGAGGCTCCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001081414.1-6730s1c1
Sequence:CCGGGCTAATCTTTGAACGTAATAACTCGAGTTATTACGTTCAAAGATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081414.1-2203s1c1
Sequence:CCGGCTGTATACAGTTGGGTATTATCTCGAGATAATACCCAACTGTATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081414.1-192s21c1
Sequence:GTACCGGACATGCCAGGTGACATTATTACTCGAGTAATAATGTCACCTGGCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081414.1-1438s1c1
Sequence:CCGGTACTGGAGTTTCCGGAGATATCTCGAGATATCTCCGGAAACTCCAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081414.1-324s1c1
Sequence:CCGGATACCTTGGAAAGGATCAATTCTCGAGAATTGATCCTTTCCAAGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081414.1-2238s1c1
Sequence:CCGGTCATGGAGCCTCCGGATATAACTCGAGTTATATCCGGAGGCTCCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081414.1-6730s21c1
Sequence:CCGGGCTAATCTTTGAACGTAATAACTCGAGTTATTACGTTCAAAGATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081414.1-2203s21c1
Sequence:CCGGCTGTATACAGTTGGGTATTATCTCGAGATAATACCCAACTGTATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081414
GRM5 MISSION shRNA shRNA Plasmid DNA
glutamate receptor, metabotropic 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081414.1-324s21c1
Sequence:CCGGATACCTTGGAAAGGATCAATTCTCGAGAATTGATCCTTTCCAAGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081414.1-2238s21c1
Sequence:CCGGTCATGGAGCCTCCGGATATAACTCGAGTTATATCCGGAGGCTCCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001081414.1-6730s1c1
Sequence:CCGGGCTAATCTTTGAACGTAATAACTCGAGTTATTACGTTCAAAGATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081414.1-2203s1c1
Sequence:CCGGCTGTATACAGTTGGGTATTATCTCGAGATAATACCCAACTGTATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081414.1-192s21c1
Sequence:GTACCGGACATGCCAGGTGACATTATTACTCGAGTAATAATGTCACCTGGCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081414.1-1438s1c1
Sequence:CCGGTACTGGAGTTTCCGGAGATATCTCGAGATATCTCCGGAAACTCCAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081414.1-324s1c1
Sequence:CCGGATACCTTGGAAAGGATCAATTCTCGAGAATTGATCCTTTCCAAGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081414.1-2238s1c1
Sequence:CCGGTCATGGAGCCTCCGGATATAACTCGAGTTATATCCGGAGGCTCCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081414.1-6730s21c1
Sequence:CCGGGCTAATCTTTGAACGTAATAACTCGAGTTATTACGTTCAAAGATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081414.1-2203s21c1
Sequence:CCGGCTGTATACAGTTGGGTATTATCTCGAGATAATACCCAACTGTATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081414
GRM5 MISSION shRNA Lentiviral Transduction Particles
glutamate receptor, metabotropic 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081414.1-324s21c1
Sequence:CCGGATACCTTGGAAAGGATCAATTCTCGAGAATTGATCCTTTCCAAGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081414.1-2238s21c1
Sequence:CCGGTCATGGAGCCTCCGGATATAACTCGAGTTATATCCGGAGGCTCCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001081414.1-6730s1c1
Sequence:CCGGGCTAATCTTTGAACGTAATAACTCGAGTTATTACGTTCAAAGATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081414.1-2203s1c1
Sequence:CCGGCTGTATACAGTTGGGTATTATCTCGAGATAATACCCAACTGTATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081414.1-192s21c1
Sequence:GTACCGGACATGCCAGGTGACATTATTACTCGAGTAATAATGTCACCTGGCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081414.1-1438s1c1
Sequence:CCGGTACTGGAGTTTCCGGAGATATCTCGAGATATCTCCGGAAACTCCAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081414.1-324s1c1
Sequence:CCGGATACCTTGGAAAGGATCAATTCTCGAGAATTGATCCTTTCCAAGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001081414.1-2238s1c1
Sequence:CCGGTCATGGAGCCTCCGGATATAACTCGAGTTATATCCGGAGGCTCCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226000    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081414.1-6730s21c1
Sequence:CCGGGCTAATCTTTGAACGTAATAACTCGAGTTATTACGTTCAAAGATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081414.1-2203s21c1
Sequence:CCGGCTGTATACAGTTGGGTATTATCTCGAGATAATACCCAACTGTATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)