EMAIL THIS PAGE TO A FRIEND

GRN

granulin

96 Gene Product Result for
Synonyms: CLN11 GEP GP88 PCDGF PEPI PGRN
Gene ID:
Human(2896) Summary: Granulins are a family of secreted, glycosylated peptides that are cleaved from a single precursor protein with 7.5 repeats of a highly conserved 12-cysteine granulin/epithelin motif. The 88 kDa precursor protein, progranulin, is also called proepithelin and PC cell-derived growth factor. Cleavage of the signal peptide produces mature granulin which can be further cleaved into a variety of active, 6 kDa peptides. These smaller cleavage products are named granulin A, granulin B, granulin C, etc. Epithelins 1 and 2 are synonymous with granulins A and B, respectively. Both the peptides and intact granulin protein regulate cell growth. However, different members of the granulin protein family may act as inhibitors, stimulators, or have dual actions on cell growth. Granulin family members are important in normal development, wound healing, and tumorigenesis. [provided by RefSeq, Jul 2008]
Mouse(14824) granulin
Rat(29143) granulin
sheep(101115470) granulin
cow(767942) granulin
Horse(100051035) granulin
dog(480501) granulin
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200310 Anti-Granulin (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4200557 Anti-Granulin antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB2501196 Anti-GRN antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB2502030 Anti-GRN antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA008763 Anti-GRN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA028747 Anti-GRN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1410570 Anti-GRN antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
WH0002896M1 Monoclonal Anti-GRN antibody produced in mouse clone 1F5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403884 Monoclonal Anti-GRN, (C-terminal) antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008175 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008175 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008175 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002087 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002087 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002087 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012479 Rosetta Predictions human pricing
NM_002087 siRNAs that have been validated in the lab human pricing
NM_017113 Rosetta Predictions rat pricing
NM_008175 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012479 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040279 predicted 966
2 SASI_Hs01_00040280 predicted 1085
3 SASI_Hs01_00040281 predicted 989
4 SASI_Hs01_00040282 predicted 974
5 SASI_Hs01_00040283 predicted 1019
6 SASI_Hs01_00040284 predicted 224
7 SASI_Hs01_00040285 predicted 1001
8 SASI_Hs01_00040286 predicted 590
9 SASI_Hs01_00040287 predicted 889
10 SASI_Hs01_00040288 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002087 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096299 validated 231
1 SASI_Hs01_00096294 validated 965
2 SASI_Hs01_00096295 predicted 1073
3 SASI_Hs01_00096296 predicted 988
4 SASI_Hs01_00096297 predicted 968
5 SASI_Hs01_00096298 predicted 1012
6 SASI_Hs01_00096300 predicted 998
7 SASI_Hs02_00333173 predicted 1281
8 SASI_Hs01_00096301 predicted 585
9 SASI_Hs02_00333174 predicted 1664
10 SASI_Hs01_00096302 predicted 882
11 SASI_Hs01_00096303 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017113 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091279 predicted 685
2 SASI_Rn01_00091280 predicted 1567
3 SASI_Rn01_00091281 predicted 1561
4 SASI_Rn01_00091282 predicted 329
5 SASI_Rn02_00261349 predicted 969
6 SASI_Rn01_00091283 predicted 936
7 SASI_Rn01_00091284 predicted 1310
8 SASI_Rn01_00091285 predicted 222
9 SASI_Rn01_00091286 predicted 752
10 SASI_Rn02_00261350 predicted 1105
11 SASI_Rn01_00091287 predicted 800
12 SASI_Rn01_00091288 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008175 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113215 predicted 786
2 SASI_Mm01_00113216 predicted 1514
3 SASI_Mm02_00313300 predicted 250
4 SASI_Mm01_00113217 predicted 1110
5 SASI_Mm01_00113218 predicted 1016
6 SASI_Mm01_00113220 predicted 971
7 SASI_Mm02_00313301 predicted 1129
8 SASI_Mm02_00313302 predicted 422
9 SASI_Mm01_00113221 predicted 1032
10 SASI_Mm02_00313303 predicted 1104
11 SASI_Mm01_00113219 predicted 1740
12 SASI_Mm01_00113222 predicted 1809
13 SASI_Mm01_00113223 predicted 1110
14 SASI_Mm01_00113224 predicted 1345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008175
VALIDATED
GRN MISSION shRNA Bacterial Glycerol Stock
granulin
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008175.4-374s21c1
Sequence:CCGGCCTAGAATAACGAGCCATCATCTCGAGATGATGGCTCGTTATTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008175.4-991s21c1
Sequence:CCGGCCAGAGTAAGTGCCTATCCAACTCGAGTTGGATAGGCACTTACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008175.4-1325s21c1
Sequence:CCGGTTCACTAGGTGTCCTACAAACCTCGAGGTTTGTAGGACACCTAGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008175.4-2104s21c1
Sequence:CCGGACTCATCCTGAGTCACCCTATCTCGAGATAGGGTGACTCAGGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008175.2-1920s1c1
Sequence:CCGGACTCATCCTGAGTCACCCTATCTCGAGATAGGGTGACTCAGGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008175.2-190s1c1
Sequence:CCGGCCTAGAATAACGAGCCATCATCTCGAGATGATGGCTCGTTATTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008175.2-1341s1c1
Sequence:CCGGCCCGCTCCAAATTGGAGATATCTCGAGATATCTCCAATTTGGAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008175.2-807s1c1
Sequence:CCGGCCAGAGTAAGTGCCTATCCAACTCGAGTTGGATAGGCACTTACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008175.2-296s1c1
Sequence:CCGGCGTTCTCTAAGGGTGTGTCTTCTCGAGAAGACACACCCTTAGAGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008175
VALIDATED
GRN MISSION shRNA shRNA Plasmid DNA
granulin
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008175.4-374s21c1
Sequence:CCGGCCTAGAATAACGAGCCATCATCTCGAGATGATGGCTCGTTATTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008175.4-991s21c1
Sequence:CCGGCCAGAGTAAGTGCCTATCCAACTCGAGTTGGATAGGCACTTACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008175.4-1325s21c1
Sequence:CCGGTTCACTAGGTGTCCTACAAACCTCGAGGTTTGTAGGACACCTAGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008175.4-2104s21c1
Sequence:CCGGACTCATCCTGAGTCACCCTATCTCGAGATAGGGTGACTCAGGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008175.2-1920s1c1
Sequence:CCGGACTCATCCTGAGTCACCCTATCTCGAGATAGGGTGACTCAGGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008175.2-190s1c1
Sequence:CCGGCCTAGAATAACGAGCCATCATCTCGAGATGATGGCTCGTTATTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008175.2-1341s1c1
Sequence:CCGGCCCGCTCCAAATTGGAGATATCTCGAGATATCTCCAATTTGGAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008175.2-807s1c1
Sequence:CCGGCCAGAGTAAGTGCCTATCCAACTCGAGTTGGATAGGCACTTACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008175.2-296s1c1
Sequence:CCGGCGTTCTCTAAGGGTGTGTCTTCTCGAGAAGACACACCCTTAGAGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008175
VALIDATED
GRN MISSION shRNA Lentiviral Transduction Particles
granulin
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008175.4-374s21c1
Sequence:CCGGCCTAGAATAACGAGCCATCATCTCGAGATGATGGCTCGTTATTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008175.4-991s21c1
Sequence:CCGGCCAGAGTAAGTGCCTATCCAACTCGAGTTGGATAGGCACTTACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008175.4-1325s21c1
Sequence:CCGGTTCACTAGGTGTCCTACAAACCTCGAGGTTTGTAGGACACCTAGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008175.4-2104s21c1
Sequence:CCGGACTCATCCTGAGTCACCCTATCTCGAGATAGGGTGACTCAGGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008175.2-1920s1c1
Sequence:CCGGACTCATCCTGAGTCACCCTATCTCGAGATAGGGTGACTCAGGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008175.2-190s1c1
Sequence:CCGGCCTAGAATAACGAGCCATCATCTCGAGATGATGGCTCGTTATTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008175.2-1341s1c1
Sequence:CCGGCCCGCTCCAAATTGGAGATATCTCGAGATATCTCCAATTTGGAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008175.2-807s1c1
Sequence:CCGGCCAGAGTAAGTGCCTATCCAACTCGAGTTGGATAGGCACTTACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008175.2-296s1c1
Sequence:CCGGCGTTCTCTAAGGGTGTGTCTTCTCGAGAAGACACACCCTTAGAGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002087
VALIDATED
GRN MISSION shRNA Bacterial Glycerol Stock
granulin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-1288s21c1
Sequence:CCGGCCACAAGCCTTGAAGAGAGATCTCGAGATCTCTCTTCAAGGCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-975s21c1
Sequence:CCGGGTGTGACCTGATCCAGAGTAACTCGAGTTACTCTGGATCAGGTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-555s21c1
Sequence:CCGGCTTCCAAAGATCAGGTAACAACTCGAGTTGTTACCTGATCTTTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-2081s21c1
Sequence:CCGGCCTAACCAAATTCTCCCTGGACTCGAGTCCAGGGAGAATTTGGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-596s21c1
Sequence:CCGGGCCCTGATAGTCAGTTCGAATCTCGAGATTCGAACTGACTATCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-2081s1c1
Sequence:CCGGCCTAACCAAATTCTCCCTGGACTCGAGTCCAGGGAGAATTTGGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-1288s1c1
Sequence:CCGGCCACAAGCCTTGAAGAGAGATCTCGAGATCTCTCTTCAAGGCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-975s1c1
Sequence:CCGGGTGTGACCTGATCCAGAGTAACTCGAGTTACTCTGGATCAGGTCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-555s1c1
Sequence:CCGGCTTCCAAAGATCAGGTAACAACTCGAGTTGTTACCTGATCTTTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-596s1c1
Sequence:CCGGGCCCTGATAGTCAGTTCGAATCTCGAGATTCGAACTGACTATCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002087
VALIDATED
GRN MISSION shRNA shRNA Plasmid DNA
granulin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-1288s21c1
Sequence:CCGGCCACAAGCCTTGAAGAGAGATCTCGAGATCTCTCTTCAAGGCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-975s21c1
Sequence:CCGGGTGTGACCTGATCCAGAGTAACTCGAGTTACTCTGGATCAGGTCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-555s21c1
Sequence:CCGGCTTCCAAAGATCAGGTAACAACTCGAGTTGTTACCTGATCTTTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-2081s21c1
Sequence:CCGGCCTAACCAAATTCTCCCTGGACTCGAGTCCAGGGAGAATTTGGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-596s21c1
Sequence:CCGGGCCCTGATAGTCAGTTCGAATCTCGAGATTCGAACTGACTATCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-2081s1c1
Sequence:CCGGCCTAACCAAATTCTCCCTGGACTCGAGTCCAGGGAGAATTTGGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-1288s1c1
Sequence:CCGGCCACAAGCCTTGAAGAGAGATCTCGAGATCTCTCTTCAAGGCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-975s1c1
Sequence:CCGGGTGTGACCTGATCCAGAGTAACTCGAGTTACTCTGGATCAGGTCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-555s1c1
Sequence:CCGGCTTCCAAAGATCAGGTAACAACTCGAGTTGTTACCTGATCTTTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-596s1c1
Sequence:CCGGGCCCTGATAGTCAGTTCGAATCTCGAGATTCGAACTGACTATCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002087
VALIDATED
GRN MISSION shRNA Lentiviral Transduction Particles
granulin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-1288s21c1
Sequence:CCGGCCACAAGCCTTGAAGAGAGATCTCGAGATCTCTCTTCAAGGCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-975s21c1
Sequence:CCGGGTGTGACCTGATCCAGAGTAACTCGAGTTACTCTGGATCAGGTCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-555s21c1
Sequence:CCGGCTTCCAAAGATCAGGTAACAACTCGAGTTGTTACCTGATCTTTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-2081s21c1
Sequence:CCGGCCTAACCAAATTCTCCCTGGACTCGAGTCCAGGGAGAATTTGGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002087.2-596s21c1
Sequence:CCGGGCCCTGATAGTCAGTTCGAATCTCGAGATTCGAACTGACTATCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115977    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-2081s1c1
Sequence:CCGGCCTAACCAAATTCTCCCTGGACTCGAGTCCAGGGAGAATTTGGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-1288s1c1
Sequence:CCGGCCACAAGCCTTGAAGAGAGATCTCGAGATCTCTCTTCAAGGCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-975s1c1
Sequence:CCGGGTGTGACCTGATCCAGAGTAACTCGAGTTACTCTGGATCAGGTCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-555s1c1
Sequence:CCGGCTTCCAAAGATCAGGTAACAACTCGAGTTGTTACCTGATCTTTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002087.2-596s1c1
Sequence:CCGGGCCCTGATAGTCAGTTCGAATCTCGAGATTCGAACTGACTATCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)