EMAIL THIS PAGE TO A FRIEND

GRXCR1

glutaredoxin, cysteine rich 1

63 Gene Product Result for
Synonyms: DFNB25
UniProtKB ID: A8MXD5
Gene ID:
Human(389207) Summary: This gene is one of 60 loci associated with autosomal-recessive nonsyndromic hearing impairment. This gene encodes a protein which contains GRX-like domains; these domains play a role in the S-glutathionylation of proteins and may be involved in actin organization in hair cells. [provided by RefSeq, Sep 2010]
Mouse(433899) glutaredoxin, cysteine rich 1
Rat(498355) glutaredoxin, cysteine rich 1
chicken(770624) glutaredoxin, cysteine rich 1
cow(527289) glutaredoxin, cysteine rich 1
domestic cat(101100050) glutaredoxin, cysteine rich 1
dog(100687779) glutaredoxin, cysteine rich 1
sheep(101119563) glutaredoxin, cysteine rich 1
domestic guinea pig(100717841) glutaredoxin, cysteine rich 1
naked mole-rat(101725030) glutaredoxin, cysteine rich 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001018019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001018019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001018019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080476 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146701 MISSION® esiRNA esiRNA human GRXCR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080476 Rosetta Predictions human pricing
XM_371694 Rosetta Predictions human pricing
XM_001077572 Rosetta Predictions rat pricing
XM_573590 Rosetta Predictions rat pricing
NM_001018019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315206 predicted 220
2 SASI_Hs02_00315207 predicted 383
3 SASI_Hs02_00315208 predicted 438
4 SASI_Hs02_00315209 predicted 454
5 SASI_Hs02_00315210 predicted 305
6 SASI_Hs02_00315211 predicted 411
7 SASI_Hs02_00315212 predicted 638
8 SASI_Hs02_00315213 predicted 362
9 SASI_Hs02_00315214 predicted 396
10 SASI_Hs02_00315215 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00263841 predicted 695
2 SASI_Hs01_00263842 predicted 690
3 SASI_Hs01_00263843 predicted 711
4 SASI_Hs01_00263844 predicted 232
5 SASI_Hs01_00263845 predicted 461
6 SASI_Hs01_00263846 predicted 817
7 SASI_Hs01_00263847 predicted 643
8 SASI_Hs01_00263848 predicted 359
9 SASI_Hs01_00263849 predicted 859
10 SASI_Hs01_00263850 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077572 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357611 predicted 228
2 SASI_Rn02_00357612 predicted 603
3 SASI_Rn02_00357613 predicted 464
4 SASI_Rn02_00357614 predicted 540
5 SASI_Rn02_00357615 predicted 200
6 SASI_Rn02_00357616 predicted 421
7 SASI_Rn02_00357617 predicted 464
8 SASI_Rn02_00357618 predicted 311
9 SASI_Rn02_00357619 predicted 422
10 SASI_Rn02_00357620 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400543 predicted 234
2 SASI_Rn02_00400544 predicted 596
3 SASI_Rn02_00400545 predicted 465
4 SASI_Rn02_00400546 predicted 540
5 SASI_Rn02_00400547 predicted 197
6 SASI_Rn02_00400548 predicted 419
7 SASI_Rn02_00400549 predicted 462
8 SASI_Rn02_00400550 predicted 306
9 SASI_Rn02_00400551 predicted 419
10 SASI_Rn02_00400552 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064689 predicted 469
2 SASI_Mm01_00064690 predicted 508
3 SASI_Mm01_00064691 predicted 467
4 SASI_Mm01_00064692 predicted 545
5 SASI_Mm01_00064693 predicted 529
6 SASI_Mm01_00064694 predicted 714
7 SASI_Mm01_00064695 predicted 376
8 SASI_Mm02_00287542 predicted 532
9 SASI_Mm01_00064696 predicted 524
10 SASI_Mm01_00064697 predicted 287
11 SASI_Mm01_00064688 predicted 733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001018019
GRXCR1 MISSION shRNA Bacterial Glycerol Stock
glutaredoxin, cysteine rich 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-570s1c1
Sequence:CCGGCGAGTAAAGTTTGAAGAGAAACTCGAGTTTCTCTTCAAACTTTACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-299s1c1
Sequence:CCGGTCAGGATAACCTGCTGGTATTCTCGAGAATACCAGCAGGTTATCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-419s1c1
Sequence:CCGGCCAGGCTCTGTTTAACAATTTCTCGAGAAATTGTTAAACAGAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-210s1c1
Sequence:CCGGGCTAGTATTTGTGCCATAGATCTCGAGATCTATGGCACAAATACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-884s1c1
Sequence:CCGGCCTCAAGTGTACAGCTTGCAACTCGAGTTGCAAGCTGTACACTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001018019
GRXCR1 MISSION shRNA shRNA Plasmid DNA
glutaredoxin, cysteine rich 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-570s1c1
Sequence:CCGGCGAGTAAAGTTTGAAGAGAAACTCGAGTTTCTCTTCAAACTTTACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-299s1c1
Sequence:CCGGTCAGGATAACCTGCTGGTATTCTCGAGAATACCAGCAGGTTATCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-419s1c1
Sequence:CCGGCCAGGCTCTGTTTAACAATTTCTCGAGAAATTGTTAAACAGAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-210s1c1
Sequence:CCGGGCTAGTATTTGTGCCATAGATCTCGAGATCTATGGCACAAATACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-884s1c1
Sequence:CCGGCCTCAAGTGTACAGCTTGCAACTCGAGTTGCAAGCTGTACACTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001018019
GRXCR1 MISSION shRNA Lentiviral Transduction Particles
glutaredoxin, cysteine rich 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-570s1c1
Sequence:CCGGCGAGTAAAGTTTGAAGAGAAACTCGAGTTTCTCTTCAAACTTTACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-299s1c1
Sequence:CCGGTCAGGATAACCTGCTGGTATTCTCGAGAATACCAGCAGGTTATCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-419s1c1
Sequence:CCGGCCAGGCTCTGTTTAACAATTTCTCGAGAAATTGTTAAACAGAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-210s1c1
Sequence:CCGGGCTAGTATTTGTGCCATAGATCTCGAGATCTATGGCACAAATACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001018019.1-884s1c1
Sequence:CCGGCCTCAAGTGTACAGCTTGCAACTCGAGTTGCAAGCTGTACACTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080476
GRXCR1 MISSION shRNA Bacterial Glycerol Stock
glutaredoxin, cysteine rich 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-522s21c1
Sequence:CCGGCATAGCCCTGAATGGTGAATACTCGAGTATTCACCATTCAGGGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-278s21c1
Sequence:CCGGGTACAAGAAGAGTCAACATTTCTCGAGAAATGTTGACTCTTCTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-153s21c1
Sequence:CCGGGATAGATGGACTAGGTGATTCCTCGAGGAATCACCTAGTCCATCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-311s21c1
Sequence:CCGGGCACAGTCAGAGGCGTCAAATCTCGAGATTTGACGCCTCTGACTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-341s21c1
Sequence:CCGGGTGCTGGCCAGGCTCTATTTACTCGAGTAAATAGAGCCTGGCCAGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080476
GRXCR1 MISSION shRNA shRNA Plasmid DNA
glutaredoxin, cysteine rich 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-522s21c1
Sequence:CCGGCATAGCCCTGAATGGTGAATACTCGAGTATTCACCATTCAGGGCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-278s21c1
Sequence:CCGGGTACAAGAAGAGTCAACATTTCTCGAGAAATGTTGACTCTTCTTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-153s21c1
Sequence:CCGGGATAGATGGACTAGGTGATTCCTCGAGGAATCACCTAGTCCATCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-311s21c1
Sequence:CCGGGCACAGTCAGAGGCGTCAAATCTCGAGATTTGACGCCTCTGACTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-341s21c1
Sequence:CCGGGTGCTGGCCAGGCTCTATTTACTCGAGTAAATAGAGCCTGGCCAGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080476
GRXCR1 MISSION shRNA Lentiviral Transduction Particles
glutaredoxin, cysteine rich 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-522s21c1
Sequence:CCGGCATAGCCCTGAATGGTGAATACTCGAGTATTCACCATTCAGGGCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-278s21c1
Sequence:CCGGGTACAAGAAGAGTCAACATTTCTCGAGAAATGTTGACTCTTCTTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-153s21c1
Sequence:CCGGGATAGATGGACTAGGTGATTCCTCGAGGAATCACCTAGTCCATCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-311s21c1
Sequence:CCGGGCACAGTCAGAGGCGTCAAATCTCGAGATTTGACGCCTCTGACTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080476.1-341s21c1
Sequence:CCGGGTGCTGGCCAGGCTCTATTTACTCGAGTAAATAGAGCCTGGCCAGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)