EMAIL THIS PAGE TO A FRIEND

GSDMA

gasdermin A

52 Gene Product Result for
Synonyms: GSDM GSDM1
UniProtKB ID: Q96QA5, Q32MC5, Q86VE7, Q8N1M6
Gene ID:
Mouse(57911) gasdermin A
Rat(360619) gasdermin A
sheep(101105583) gasdermin A
chicken(426132) gasdermin A
cow(618583) gasdermin A
Horse(100054598) gasdermin A
dog(608276) gasdermin A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021347 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021347 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021347 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178171 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046351 MISSION® esiRNA esiRNA human GSDMA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178171 Rosetta Predictions human pricing
NM_001108297 Rosetta Predictions rat pricing
NM_021347 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369584 predicted 449
2 SASI_Hs01_00130596 predicted 1182
3 SASI_Hs01_00130598 predicted 1124
4 SASI_Hs01_00130599 predicted 310
5 SASI_Hs01_00130600 predicted 458
6 SASI_Hs01_00130602 predicted 1231
7 SASI_Hs01_00130603 predicted 834
8 SASI_Hs01_00130604 predicted 667
9 SASI_Hs02_00369585 predicted 1211
10 SASI_Hs01_00130605 predicted 910
11 SASI_Hs01_00130597 predicted 323
12 SASI_Hs01_00130601 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237269 predicted 494
2 SASI_Rn02_00237270 predicted 379
3 SASI_Rn02_00237271 predicted 641
4 SASI_Rn02_00237272 predicted 691
5 SASI_Rn02_00237273 predicted 988
6 SASI_Rn02_00237274 predicted 715
7 SASI_Rn02_00237275 predicted 703
8 SASI_Rn02_00237276 predicted 719
9 SASI_Rn02_00237277 predicted 671
10 SASI_Rn02_00237278 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106897 predicted 360
2 SASI_Mm01_00106898 predicted 1520
3 SASI_Mm01_00106899 predicted 714
4 SASI_Mm01_00106900 predicted 809
5 SASI_Mm01_00106901 predicted 330
6 SASI_Mm01_00106902 predicted 1123
7 SASI_Mm01_00106903 predicted 750
8 SASI_Mm01_00106904 predicted 1406
9 SASI_Mm01_00106905 predicted 1406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021347
GSDMA MISSION shRNA Bacterial Glycerol Stock
gasdermin A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021347.2-1132s1c1
Sequence:CCGGCCAACAGAAGCTTCTAGTAAACTCGAGTTTACTAGAAGCTTCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021347.2-317s1c1
Sequence:CCGGGACAGTGGCAACTTTAGCTTTCTCGAGAAAGCTAAAGTTGCCACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021347.2-2338s1c1
Sequence:CCGGGCACCCAAGAATAAGACCTAACTCGAGTTAGGTCTTATTCTTGGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021347.3-723s21c1
Sequence:CCGGACTGATGGTCAACGGCAAAGACTCGAGTCTTTGCCGTTGACCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021347.3-2411s21c1
Sequence:CCGGTGACTCACAGGAGTTGCATATCTCGAGATATGCAACTCCTGTGAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021347.3-806s21c1
Sequence:CCGGCAGGAGAAGGGAAGTTCATATCTCGAGATATGAACTTCCCTTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021347.3-1131s21c1
Sequence:CCGGCCAACAGAAGCTTCTAGTAAACTCGAGTTTACTAGAAGCTTCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021347.3-752s21c1
Sequence:CCGGGCATTCCACACATTTGCAATGCTCGAGCATTGCAAATGTGTGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021347
GSDMA MISSION shRNA shRNA Plasmid DNA
gasdermin A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021347.2-1132s1c1
Sequence:CCGGCCAACAGAAGCTTCTAGTAAACTCGAGTTTACTAGAAGCTTCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021347.2-317s1c1
Sequence:CCGGGACAGTGGCAACTTTAGCTTTCTCGAGAAAGCTAAAGTTGCCACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021347.2-2338s1c1
Sequence:CCGGGCACCCAAGAATAAGACCTAACTCGAGTTAGGTCTTATTCTTGGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021347.3-723s21c1
Sequence:CCGGACTGATGGTCAACGGCAAAGACTCGAGTCTTTGCCGTTGACCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021347.3-2411s21c1
Sequence:CCGGTGACTCACAGGAGTTGCATATCTCGAGATATGCAACTCCTGTGAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021347.3-806s21c1
Sequence:CCGGCAGGAGAAGGGAAGTTCATATCTCGAGATATGAACTTCCCTTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021347.3-1131s21c1
Sequence:CCGGCCAACAGAAGCTTCTAGTAAACTCGAGTTTACTAGAAGCTTCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021347.3-752s21c1
Sequence:CCGGGCATTCCACACATTTGCAATGCTCGAGCATTGCAAATGTGTGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021347
GSDMA MISSION shRNA Lentiviral Transduction Particles
gasdermin A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021347.2-1132s1c1
Sequence:CCGGCCAACAGAAGCTTCTAGTAAACTCGAGTTTACTAGAAGCTTCTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021347.2-317s1c1
Sequence:CCGGGACAGTGGCAACTTTAGCTTTCTCGAGAAAGCTAAAGTTGCCACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021347.2-2338s1c1
Sequence:CCGGGCACCCAAGAATAAGACCTAACTCGAGTTAGGTCTTATTCTTGGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021347.3-723s21c1
Sequence:CCGGACTGATGGTCAACGGCAAAGACTCGAGTCTTTGCCGTTGACCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021347.3-2411s21c1
Sequence:CCGGTGACTCACAGGAGTTGCATATCTCGAGATATGCAACTCCTGTGAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021347.3-806s21c1
Sequence:CCGGCAGGAGAAGGGAAGTTCATATCTCGAGATATGAACTTCCCTTCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021347.3-1131s21c1
Sequence:CCGGCCAACAGAAGCTTCTAGTAAACTCGAGTTTACTAGAAGCTTCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021347.3-752s21c1
Sequence:CCGGGCATTCCACACATTTGCAATGCTCGAGCATTGCAAATGTGTGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178171
GSDMA MISSION shRNA Bacterial Glycerol Stock
gasdermin A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178171.2-538s1c1
Sequence:CCGGCTGAAGGAGATGCAAGATCAACTCGAGTTGATCTTGCATCTCCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178171.4-1595s21c1
Sequence:CCGGTCCACCTGCCCAACCATATATCTCGAGATATATGGTTGGGCAGGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178171.4-1394s21c1
Sequence:CCGGCCTCGCCTCTGTGCTCTTTATCTCGAGATAAAGAGCACAGAGGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178171.4-668s21c1
Sequence:CCGGGGGCTACAGGGATCCATAAATCTCGAGATTTATGGATCCCTGTAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178171.4-759s21c1
Sequence:CCGGGCAAAGATGAGTGGGATATTCCTCGAGGAATATCCCACTCATCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178171.4-1439s21c1
Sequence:CCGGCTTACCAAGGCCTCCTAATTTCTCGAGAAATTAGGAGGCCTTGGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178171
GSDMA MISSION shRNA shRNA Plasmid DNA
gasdermin A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178171.2-538s1c1
Sequence:CCGGCTGAAGGAGATGCAAGATCAACTCGAGTTGATCTTGCATCTCCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178171.4-1595s21c1
Sequence:CCGGTCCACCTGCCCAACCATATATCTCGAGATATATGGTTGGGCAGGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178171.4-1394s21c1
Sequence:CCGGCCTCGCCTCTGTGCTCTTTATCTCGAGATAAAGAGCACAGAGGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178171.4-668s21c1
Sequence:CCGGGGGCTACAGGGATCCATAAATCTCGAGATTTATGGATCCCTGTAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178171.4-759s21c1
Sequence:CCGGGCAAAGATGAGTGGGATATTCCTCGAGGAATATCCCACTCATCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178171.4-1439s21c1
Sequence:CCGGCTTACCAAGGCCTCCTAATTTCTCGAGAAATTAGGAGGCCTTGGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178171
GSDMA MISSION shRNA Lentiviral Transduction Particles
gasdermin A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178171.2-538s1c1
Sequence:CCGGCTGAAGGAGATGCAAGATCAACTCGAGTTGATCTTGCATCTCCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178171.4-1595s21c1
Sequence:CCGGTCCACCTGCCCAACCATATATCTCGAGATATATGGTTGGGCAGGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178171.4-1394s21c1
Sequence:CCGGCCTCGCCTCTGTGCTCTTTATCTCGAGATAAAGAGCACAGAGGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178171.4-668s21c1
Sequence:CCGGGGGCTACAGGGATCCATAAATCTCGAGATTTATGGATCCCTGTAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178171.4-759s21c1
Sequence:CCGGGCAAAGATGAGTGGGATATTCCTCGAGGAATATCCCACTCATCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178171.4-1439s21c1
Sequence:CCGGCTTACCAAGGCCTCCTAATTTCTCGAGAAATTAGGAGGCCTTGGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)