EMAIL THIS PAGE TO A FRIEND

GSKIP

GSK3B interacting protein

144 Gene Product Result for
Synonyms: C14orf129
UniProtKB ID: Q9P0R6, B3KSZ0, Q9BST1, Q9NWK0
Gene ID:
Human(51527) Summary: This gene encodes a protein that is involved as a negative regulator of GSK3-beta in the Wnt signaling pathway. The encoded protein may play a role in the retinoic acid signaling pathway by regulating the functional interactions between GSK3-beta, beta-catenin and cyclin D1, and it regulates the beta-catenin/N-cadherin pool. The encoded protein contains a GSK3-beta interacting domain (GID) in its C-terminus, which is similar to the GID of Axin. The protein also contains an evolutionarily conserved RII-binding domain, which facilitates binding with protein kinase-A and GSK3-beta, enabling its role as an A-kinase anchoring protein. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
Mouse(66787) GSK3B interacting protein
Rat(362778) GSK3B interacting protein
Zebrafish(406744) gsk3b interacting protein
cow(616052) GSK3B interacting protein
domestic cat(101082921) GSK3B interacting protein
dog(611079) GSK3B interacting protein
sheep(101121297) GSK3B interacting protein
domestic guinea pig(100725078) GSK3B interacting protein
naked mole-rat(101716184) GSK3B interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016472 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015161 MISSION® esiRNA esiRNA targeting human C14orf129 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016472 Rosetta Predictions human pricing
NM_001014198 Rosetta Predictions rat pricing
NM_178613 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091981 predicted 288
2 SASI_Hs01_00091983 predicted 244
3 SASI_Hs01_00091984 predicted 282
4 SASI_Hs01_00091985 predicted 688
5 SASI_Hs01_00091986 predicted 227
6 SASI_Hs01_00091987 predicted 736
7 SASI_Hs01_00091988 predicted 721
8 SASI_Hs01_00091989 predicted 716
9 SASI_Hs01_00091990 predicted 756
10 SASI_Hs02_00349517 predicted 287
11 SASI_Hs01_00091982 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049184 predicted 516
2 SASI_Rn01_00049185 predicted 954
3 SASI_Rn01_00049186 predicted 404
4 SASI_Rn01_00049188 predicted 463
5 SASI_Rn01_00049189 predicted 880
6 SASI_Rn01_00049190 predicted 605
7 SASI_Rn01_00049191 predicted 440
8 SASI_Rn01_00049192 predicted 553
9 SASI_Rn01_00049193 predicted 882
10 SASI_Rn02_00201719 predicted 803
11 SASI_Rn01_00049187 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147402 predicted 867
2 SASI_Mm01_00147403 predicted 418
3 SASI_Mm01_00147404 predicted 283
4 SASI_Mm01_00147405 predicted 777
5 SASI_Mm01_00147406 predicted 564
6 SASI_Mm01_00147407 predicted 899
7 SASI_Mm01_00147408 predicted 944
8 SASI_Mm01_00147409 predicted 679
9 SASI_Mm01_00147410 predicted 967
10 SASI_Mm02_00348963 predicted 243
11 SASI_Mm01_00147411 predicted 921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016472
VALIDATED
GSKIP MISSION shRNA Bacterial Glycerol Stock
GSK3B interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016472.2-446s1c1
Sequence:CCGGCCATGAAACAGTCTACTCCTTCTCGAGAAGGAGTAGACTGTTTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016472.2-253s1c1
Sequence:CCGGCAGTTGTAAATGATGTTCTCTCTCGAGAGAGAACATCATTTACAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016472.2-510s1c1
Sequence:CCGGGCACTGCTTCAAAGACTGGAACTCGAGTTCCAGTCTTTGAAGCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016472.2-224s1c1
Sequence:CCGGCATGAAAGACATGAGGCTCGACTCGAGTCGAGCCTCATGTCTTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016472.3-358s21c1
Sequence:CCGGCTCAAGGTGGTAGGCTATGCTCTCGAGAGCATAGCCTACCACCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016472.3-133s21c1
Sequence:CCGGCTAAGCAGTATGTCAGGATTTCTCGAGAAATCCTGACATACTGCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016472.3-381s21c1
Sequence:CCGGTGACCAGGTAGATGATCATTTCTCGAGAAATGATCATCTACCTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016472.3-941s21c1
Sequence:CCGGGGACAAACTTTGTAGTAATTACTCGAGTAATTACTACAAAGTTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016472.3-283s21c1
Sequence:CCGGGCGGATGATGTGGCCTATATCCTCGAGGATATAGGCCACATCATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016472.3-724s21c1
Sequence:CCGGGTTGCTATGATACCATCATTACTCGAGTAATGATGGTATCATAGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016472
VALIDATED
GSKIP MISSION shRNA shRNA Plasmid DNA
GSK3B interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016472.2-446s1c1
Sequence:CCGGCCATGAAACAGTCTACTCCTTCTCGAGAAGGAGTAGACTGTTTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016472.2-253s1c1
Sequence:CCGGCAGTTGTAAATGATGTTCTCTCTCGAGAGAGAACATCATTTACAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016472.2-510s1c1
Sequence:CCGGGCACTGCTTCAAAGACTGGAACTCGAGTTCCAGTCTTTGAAGCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016472.2-224s1c1
Sequence:CCGGCATGAAAGACATGAGGCTCGACTCGAGTCGAGCCTCATGTCTTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016472.3-358s21c1
Sequence:CCGGCTCAAGGTGGTAGGCTATGCTCTCGAGAGCATAGCCTACCACCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016472.3-133s21c1
Sequence:CCGGCTAAGCAGTATGTCAGGATTTCTCGAGAAATCCTGACATACTGCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016472.3-381s21c1
Sequence:CCGGTGACCAGGTAGATGATCATTTCTCGAGAAATGATCATCTACCTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016472.3-941s21c1
Sequence:CCGGGGACAAACTTTGTAGTAATTACTCGAGTAATTACTACAAAGTTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016472.3-283s21c1
Sequence:CCGGGCGGATGATGTGGCCTATATCCTCGAGGATATAGGCCACATCATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016472.3-724s21c1
Sequence:CCGGGTTGCTATGATACCATCATTACTCGAGTAATGATGGTATCATAGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016472
VALIDATED
GSKIP MISSION shRNA Lentiviral Transduction Particles
GSK3B interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016472.2-446s1c1
Sequence:CCGGCCATGAAACAGTCTACTCCTTCTCGAGAAGGAGTAGACTGTTTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016472.2-253s1c1
Sequence:CCGGCAGTTGTAAATGATGTTCTCTCTCGAGAGAGAACATCATTTACAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016472.2-510s1c1
Sequence:CCGGGCACTGCTTCAAAGACTGGAACTCGAGTTCCAGTCTTTGAAGCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016472.2-224s1c1
Sequence:CCGGCATGAAAGACATGAGGCTCGACTCGAGTCGAGCCTCATGTCTTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016472.3-358s21c1
Sequence:CCGGCTCAAGGTGGTAGGCTATGCTCTCGAGAGCATAGCCTACCACCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016472.3-133s21c1
Sequence:CCGGCTAAGCAGTATGTCAGGATTTCTCGAGAAATCCTGACATACTGCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016472.3-381s21c1
Sequence:CCGGTGACCAGGTAGATGATCATTTCTCGAGAAATGATCATCTACCTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365066    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016472.3-941s21c1
Sequence:CCGGGGACAAACTTTGTAGTAATTACTCGAGTAATTACTACAAAGTTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016472.3-283s21c1
Sequence:CCGGGCGGATGATGTGGCCTATATCCTCGAGGATATAGGCCACATCATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369973    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016472.3-724s21c1
Sequence:CCGGGTTGCTATGATACCATCATTACTCGAGTAATGATGGTATCATAGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178613
GSKIP MISSION shRNA Bacterial Glycerol Stock
GSK3B interacting protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178613.2-329s1c1
Sequence:CCGGCCATGAGACAGTCTACTCCTTCTCGAGAAGGAGTAGACTGTCTCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178613.2-132s1c1
Sequence:CCGGGAGGCAGTTGTAAACGATGTACTCGAGTACATCGTTTACAACTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178613.2-138s1c1
Sequence:CCGGGTTGTAAACGATGTACTCTTTCTCGAGAAAGAGTACATCGTTTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215795    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178613.3-563s1c1
Sequence:CCGGCTGGTATAGAATCTAACATAACTCGAGTTATGTTAGATTCTATACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178613.3-177s21c1
Sequence:CCGGTGGGTTTGAAGGAGCGGATATCTCGAGATATCCGCTCCTTCAAACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178613.3-1616s21c1
Sequence:CCGGCCGGTGTTTATAAACGTAATACTCGAGTATTACGTTTATAAACACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178613.3-384s21c1
Sequence:CCGGTGACCAGGTGGAGGATCATTTCTCGAGAAATGATCCTCCACCTGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178613.3-137s21c1
Sequence:CCGGTAAGCAGTATGTCTGGATTTGCTCGAGCAAATCCAGACATACTGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178613
GSKIP MISSION shRNA shRNA Plasmid DNA
GSK3B interacting protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178613.2-329s1c1
Sequence:CCGGCCATGAGACAGTCTACTCCTTCTCGAGAAGGAGTAGACTGTCTCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178613.2-132s1c1
Sequence:CCGGGAGGCAGTTGTAAACGATGTACTCGAGTACATCGTTTACAACTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178613.2-138s1c1
Sequence:CCGGGTTGTAAACGATGTACTCTTTCTCGAGAAAGAGTACATCGTTTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215795    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178613.3-563s1c1
Sequence:CCGGCTGGTATAGAATCTAACATAACTCGAGTTATGTTAGATTCTATACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178613.3-177s21c1
Sequence:CCGGTGGGTTTGAAGGAGCGGATATCTCGAGATATCCGCTCCTTCAAACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178613.3-1616s21c1
Sequence:CCGGCCGGTGTTTATAAACGTAATACTCGAGTATTACGTTTATAAACACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178613.3-384s21c1
Sequence:CCGGTGACCAGGTGGAGGATCATTTCTCGAGAAATGATCCTCCACCTGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178613.3-137s21c1
Sequence:CCGGTAAGCAGTATGTCTGGATTTGCTCGAGCAAATCCAGACATACTGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178613
GSKIP MISSION shRNA Lentiviral Transduction Particles
GSK3B interacting protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178613.2-329s1c1
Sequence:CCGGCCATGAGACAGTCTACTCCTTCTCGAGAAGGAGTAGACTGTCTCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178613.2-132s1c1
Sequence:CCGGGAGGCAGTTGTAAACGATGTACTCGAGTACATCGTTTACAACTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178613.2-138s1c1
Sequence:CCGGGTTGTAAACGATGTACTCTTTCTCGAGAAAGAGTACATCGTTTACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215795    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178613.3-563s1c1
Sequence:CCGGCTGGTATAGAATCTAACATAACTCGAGTTATGTTAGATTCTATACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178613.3-177s21c1
Sequence:CCGGTGGGTTTGAAGGAGCGGATATCTCGAGATATCCGCTCCTTCAAACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178613.3-1616s21c1
Sequence:CCGGCCGGTGTTTATAAACGTAATACTCGAGTATTACGTTTATAAACACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178613.3-384s21c1
Sequence:CCGGTGACCAGGTGGAGGATCATTTCTCGAGAAATGATCCTCCACCTGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178613.3-137s21c1
Sequence:CCGGTAAGCAGTATGTCTGGATTTGCTCGAGCAAATCCAGACATACTGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)