EMAIL THIS PAGE TO A FRIEND

GSN

gelsolin

142 Gene Product Result for
Synonyms: ADF AGEL
Gene ID:
Human(2934) Summary: The protein encoded by this gene binds to the 'plus' ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(227753) gelsolin
Rat(296654) gelsolin
chicken(395774) gelsolin
dog(474819) gelsolin
Horse(100034186) gelsolin
cow(535077) gelsolin
sheep(100579169) gelsolin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200750 Anti-Gelsolin antibody, Mouse Monoclonal clone GS-2C4, purified from hybridoma cell culture New rabbit, monkey, canine, human, mouse
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB2500461 Anti-Gelsolin/GSN antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, canine, human
ELISA, western blot pricing
SAB2502054 Anti-GSN (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB1405898 Anti-GSN antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV54299 Anti-GSN antibody produced in rabbit affinity isolated antibody rat, canine, mouse, human, bovine, zebrafish, guinea pig, sheep, horse, pig, rabbit
western blot pricing
SAB1410584 Anti-GSN antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA054026 Anti-GSN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry, western blot pricing
G4896 Monoclonal Anti-Gelsolin antibody produced in mouse clone GS-2C4, ascites fluid pig, bovine, human, rabbit
ELISA, immunohistochemistry, microarray, western blot pricing
WH0002934M1 Monoclonal Anti-GSN antibody produced in mouse clone 3G5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, immunoprecipitation (IP), western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0504 AQUA Peptide TPITVV[K] human pricing
AQ0505 AQUA Peptide EPGLQIW[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000177 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146120 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146120 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146120 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000177 Rosetta Predictions human pricing
NM_001127662 Rosetta Predictions human pricing
NM_001127663 Rosetta Predictions human pricing
NM_001127664 Rosetta Predictions human pricing
NM_001127665 Rosetta Predictions human pricing
NM_001127666 Rosetta Predictions human pricing
NM_001127667 Rosetta Predictions human pricing
NM_198252 Rosetta Predictions human pricing
NM_001004080 Rosetta Predictions rat pricing
NM_146120 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209953 predicted 1790
2 SASI_Hs01_00209954 predicted 768
3 SASI_Hs01_00209955 predicted 1290
4 SASI_Hs01_00209956 predicted 1470
5 SASI_Hs01_00209957 predicted 1448
6 SASI_Hs02_00302016 predicted 744
7 SASI_Hs02_00302017 predicted 1663
8 SASI_Hs01_00209950 predicted 1142
9 SASI_Hs01_00209951 predicted 2178
10 SASI_Hs01_00209952 predicted 560
11 SASI_Hs01_00209958 predicted 2080
12 SASI_Hs01_00209959 predicted 2225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330024 predicted 1705
2 SASI_Hs02_00330025 predicted 678
3 SASI_Hs02_00330026 predicted 1203
4 SASI_Hs02_00330027 predicted 1383
5 SASI_Hs02_00330028 predicted 1357
6 SASI_Hs02_00330029 predicted 661
7 SASI_Hs02_00330030 predicted 1585
8 SASI_Hs02_00330031 predicted 1061
9 SASI_Hs02_00330032 predicted 2092
10 SASI_Hs02_00330033 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330034 predicted 1902
2 SASI_Hs02_00330035 predicted 884
3 SASI_Hs02_00330036 predicted 1404
4 SASI_Hs02_00330037 predicted 1595
5 SASI_Hs02_00330038 predicted 1565
6 SASI_Hs02_00330039 predicted 868
7 SASI_Hs02_00330040 predicted 1787
8 SASI_Hs02_00330041 predicted 1265
9 SASI_Hs02_00330042 predicted 2292
10 SASI_Hs02_00330043 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330044 predicted 1870
2 SASI_Hs02_00330045 predicted 849
3 SASI_Hs02_00330046 predicted 1373
4 SASI_Hs02_00330047 predicted 1557
5 SASI_Hs02_00330048 predicted 1534
6 SASI_Hs02_00330049 predicted 832
7 SASI_Hs02_00330050 predicted 1756
8 SASI_Hs02_00330051 predicted 1233
9 SASI_Hs02_00330052 predicted 2263
10 SASI_Hs02_00330053 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330054 predicted 1864
2 SASI_Hs02_00330055 predicted 849
3 SASI_Hs02_00330056 predicted 1372
4 SASI_Hs02_00330057 predicted 1555
5 SASI_Hs02_00330058 predicted 1529
6 SASI_Hs02_00330059 predicted 827
7 SASI_Hs02_00330060 predicted 1750
8 SASI_Hs02_00330061 predicted 1226
9 SASI_Hs02_00330062 predicted 2259
10 SASI_Hs02_00330063 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127666 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330064 predicted 1867
2 SASI_Hs02_00330065 predicted 844
3 SASI_Hs02_00330066 predicted 1372
4 SASI_Hs02_00330067 predicted 1553
5 SASI_Hs02_00330068 predicted 1521
6 SASI_Hs02_00330069 predicted 821
7 SASI_Hs02_00330070 predicted 1747
8 SASI_Hs02_00330071 predicted 1224
9 SASI_Hs02_00330072 predicted 2256
10 SASI_Hs02_00330073 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330074 predicted 1859
2 SASI_Hs02_00330075 predicted 829
3 SASI_Hs02_00330076 predicted 1357
4 SASI_Hs02_00330077 predicted 1543
5 SASI_Hs02_00330078 predicted 1511
6 SASI_Hs02_00330079 predicted 821
7 SASI_Hs02_00330080 predicted 1732
8 SASI_Hs02_00330081 predicted 1213
9 SASI_Hs02_00330082 predicted 2244
10 SASI_Hs02_00330083 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037522 predicted 1797
2 SASI_Hs01_00037523 predicted 774
3 SASI_Hs01_00037524 predicted 1298
4 SASI_Hs01_00037525 predicted 1475
5 SASI_Hs01_00037526 predicted 1447
6 SASI_Hs02_00371782 predicted 752
7 SASI_Hs02_00371783 predicted 1670
8 SASI_Hs01_00037519 predicted 1148
9 SASI_Hs01_00037520 predicted 2182
10 SASI_Hs01_00037521 predicted 568
11 SASI_Hs01_00037527 predicted 2082
12 SASI_Hs01_00037528 predicted 2229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061996 predicted 692
2 SASI_Rn01_00061997 predicted 2119
3 SASI_Rn01_00061998 predicted 862
4 SASI_Rn02_00198107 predicted 2033
5 SASI_Rn02_00198108 predicted 769
6 SASI_Rn01_00062000 predicted 2081
7 SASI_Rn01_00062001 predicted 1413
8 SASI_Rn01_00062002 predicted 975
9 SASI_Rn01_00062003 predicted 1356
10 SASI_Rn01_00062005 predicted 453
11 SASI_Rn01_00061999 predicted 476
12 SASI_Rn01_00062004 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146120 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051001 predicted 1699
2 SASI_Mm01_00051002 predicted 350
3 SASI_Mm01_00051003 predicted 1398
4 SASI_Mm01_00051004 predicted 1427
5 SASI_Mm01_00051005 predicted 1762
6 SASI_Mm01_00051006 predicted 489
7 SASI_Mm01_00051007 predicted 709
8 SASI_Mm01_00051008 predicted 351
9 SASI_Mm02_00341783 predicted 2092
10 SASI_Mm01_00051009 predicted 467
11 SASI_Mm01_00051010 predicted 1374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000177
VALIDATED
GSN MISSION shRNA Bacterial Glycerol Stock
gelsolin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-2076s21c1
Sequence:CCGGGCTCCAACAAGATTGGACGTTCTCGAGAACGTCCAATCTTGTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-1219s21c1
Sequence:CCGGCCCACTGTTCAAGCAGTTCTTCTCGAGAAGAACTGCTTGAACAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-1474s21c1
Sequence:CCGGCGACAGCTACATCATTCTGTACTCGAGTACAGAATGATGTAGCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-307s21c1
Sequence:CCGGCACCAACCTTTATGGAGACTTCTCGAGAAGTCTCCATAAAGGTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-750s21c1
Sequence:CCGGCCAACAGCAATCGGTATGAAACTCGAGTTTCATACCGATTGCTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000177.3-1205s1c1
Sequence:CCGGCCCACTGTTCAAGCAGTTCTTCTCGAGAAGAACTGCTTGAACAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000177.3-1460s1c1
Sequence:CCGGCGACAGCTACATCATTCTGTACTCGAGTACAGAATGATGTAGCTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000177.3-2062s1c1
Sequence:CCGGGCTCCAACAAGATTGGACGTTCTCGAGAACGTCCAATCTTGTTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000177.3-293s1c1
Sequence:CCGGCACCAACCTTTATGGAGACTTCTCGAGAAGTCTCCATAAAGGTTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000177.3-736s1c1
Sequence:CCGGCCAACAGCAATCGGTATGAAACTCGAGTTTCATACCGATTGCTGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000177
VALIDATED
GSN MISSION shRNA shRNA Plasmid DNA
gelsolin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-2076s21c1
Sequence:CCGGGCTCCAACAAGATTGGACGTTCTCGAGAACGTCCAATCTTGTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-1219s21c1
Sequence:CCGGCCCACTGTTCAAGCAGTTCTTCTCGAGAAGAACTGCTTGAACAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-1474s21c1
Sequence:CCGGCGACAGCTACATCATTCTGTACTCGAGTACAGAATGATGTAGCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-307s21c1
Sequence:CCGGCACCAACCTTTATGGAGACTTCTCGAGAAGTCTCCATAAAGGTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-750s21c1
Sequence:CCGGCCAACAGCAATCGGTATGAAACTCGAGTTTCATACCGATTGCTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000177.3-1205s1c1
Sequence:CCGGCCCACTGTTCAAGCAGTTCTTCTCGAGAAGAACTGCTTGAACAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000177.3-1460s1c1
Sequence:CCGGCGACAGCTACATCATTCTGTACTCGAGTACAGAATGATGTAGCTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000177.3-2062s1c1
Sequence:CCGGGCTCCAACAAGATTGGACGTTCTCGAGAACGTCCAATCTTGTTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000177.3-293s1c1
Sequence:CCGGCACCAACCTTTATGGAGACTTCTCGAGAAGTCTCCATAAAGGTTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000177.3-736s1c1
Sequence:CCGGCCAACAGCAATCGGTATGAAACTCGAGTTTCATACCGATTGCTGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000177
VALIDATED
GSN MISSION shRNA Lentiviral Transduction Particles
gelsolin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-2076s21c1
Sequence:CCGGGCTCCAACAAGATTGGACGTTCTCGAGAACGTCCAATCTTGTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-1219s21c1
Sequence:CCGGCCCACTGTTCAAGCAGTTCTTCTCGAGAAGAACTGCTTGAACAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-1474s21c1
Sequence:CCGGCGACAGCTACATCATTCTGTACTCGAGTACAGAATGATGTAGCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-307s21c1
Sequence:CCGGCACCAACCTTTATGGAGACTTCTCGAGAAGTCTCCATAAAGGTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000177.4-750s21c1
Sequence:CCGGCCAACAGCAATCGGTATGAAACTCGAGTTTCATACCGATTGCTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000177.3-1205s1c1
Sequence:CCGGCCCACTGTTCAAGCAGTTCTTCTCGAGAAGAACTGCTTGAACAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000177.3-1460s1c1
Sequence:CCGGCGACAGCTACATCATTCTGTACTCGAGTACAGAATGATGTAGCTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000177.3-2062s1c1
Sequence:CCGGGCTCCAACAAGATTGGACGTTCTCGAGAACGTCCAATCTTGTTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000177.3-293s1c1
Sequence:CCGGCACCAACCTTTATGGAGACTTCTCGAGAAGTCTCCATAAAGGTTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000177.3-736s1c1
Sequence:CCGGCCAACAGCAATCGGTATGAAACTCGAGTTTCATACCGATTGCTGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146120
VALIDATED
GSN MISSION shRNA Bacterial Glycerol Stock
gelsolin
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146120.3-784s21c1
Sequence:CCGGGCTCAAGTACACGTGTCTGAACTCGAGTTCAGACACGTGTACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146120.3-2050s21c1
Sequence:CCGGCGCTTTGTGATCGAAGAGGTTCTCGAGAACCTCTTCGATCACAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146120.3-340s21c1
Sequence:CCGGCTGCAGTATGACCTCCACTATCTCGAGATAGTGGAGGTCATACTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146120.3-2190s21c1
Sequence:CCGGGACTTCTGCTAAGCGGTACATCTCGAGATGTACCGCTTAGCAGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146120.2-2050s1c1
Sequence:CCGGCGCTTTGTGATCGAAGAGGTTCTCGAGAACCTCTTCGATCACAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146120.2-494s1c1
Sequence:CCGGGCTACTTCAAGTCTGGACTTACTCGAGTAAGTCCAGACTTGAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146120.2-2190s1c1
Sequence:CCGGGACTTCTGCTAAGCGGTACATCTCGAGATGTACCGCTTAGCAGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146120.2-784s1c1
Sequence:CCGGGCTCAAGTACACGTGTCTGAACTCGAGTTCAGACACGTGTACTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146120
VALIDATED
GSN MISSION shRNA shRNA Plasmid DNA
gelsolin
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146120.3-784s21c1
Sequence:CCGGGCTCAAGTACACGTGTCTGAACTCGAGTTCAGACACGTGTACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146120.3-2050s21c1
Sequence:CCGGCGCTTTGTGATCGAAGAGGTTCTCGAGAACCTCTTCGATCACAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146120.3-340s21c1
Sequence:CCGGCTGCAGTATGACCTCCACTATCTCGAGATAGTGGAGGTCATACTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146120.3-2190s21c1
Sequence:CCGGGACTTCTGCTAAGCGGTACATCTCGAGATGTACCGCTTAGCAGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146120.2-2050s1c1
Sequence:CCGGCGCTTTGTGATCGAAGAGGTTCTCGAGAACCTCTTCGATCACAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146120.2-494s1c1
Sequence:CCGGGCTACTTCAAGTCTGGACTTACTCGAGTAAGTCCAGACTTGAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146120.2-2190s1c1
Sequence:CCGGGACTTCTGCTAAGCGGTACATCTCGAGATGTACCGCTTAGCAGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146120.2-784s1c1
Sequence:CCGGGCTCAAGTACACGTGTCTGAACTCGAGTTCAGACACGTGTACTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146120
VALIDATED
GSN MISSION shRNA Lentiviral Transduction Particles
gelsolin
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146120.3-784s21c1
Sequence:CCGGGCTCAAGTACACGTGTCTGAACTCGAGTTCAGACACGTGTACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146120.3-2050s21c1
Sequence:CCGGCGCTTTGTGATCGAAGAGGTTCTCGAGAACCTCTTCGATCACAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146120.3-340s21c1
Sequence:CCGGCTGCAGTATGACCTCCACTATCTCGAGATAGTGGAGGTCATACTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146120.3-2190s21c1
Sequence:CCGGGACTTCTGCTAAGCGGTACATCTCGAGATGTACCGCTTAGCAGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146120.2-2050s1c1
Sequence:CCGGCGCTTTGTGATCGAAGAGGTTCTCGAGAACCTCTTCGATCACAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146120.2-494s1c1
Sequence:CCGGGCTACTTCAAGTCTGGACTTACTCGAGTAAGTCCAGACTTGAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146120.2-2190s1c1
Sequence:CCGGGACTTCTGCTAAGCGGTACATCTCGAGATGTACCGCTTAGCAGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146120.2-784s1c1
Sequence:CCGGGCTCAAGTACACGTGTCTGAACTCGAGTTCAGACACGTGTACTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)