EMAIL THIS PAGE TO A FRIEND

GSPT1

G1 to S phase transition 1

94 Gene Product Result for
Synonyms: 551G9.2 ETF3A GST1 eRF3a
UniProtKB ID: P15170, J3KQG6, Q96GF2
Gene ID:
Mouse(14852) G1 to S phase transition 1
Rat(24420) G1 to S phase transition 1
Zebrafish(445485) G1 to S phase transition 1
dog(479846) G1 to S phase transition 1
domestic cat(101082538) G1 to S phase transition 1
cow(532337) G1 to S phase transition 1
Horse(100055960) G1 to S phase transition 1
chicken(768522) G1 to S phase transition 1
sheep(101110724) G1 to S phase transition 1
domestic guinea pig(100727723) G1 to S phase transition 1
naked mole-rat(101721398) G1 to S phase transition 1
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002094 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002094 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002094 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU008141 MISSION® esiRNA esiRNA targeting mouse Gspt1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002094 Rosetta Predictions human pricing
NM_001003978 Rosetta Predictions rat pricing
NM_001130008 Rosetta Predictions mouse pricing
NM_146066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209030 predicted 1492
2 SASI_Hs01_00209031 predicted 999
3 SASI_Hs01_00209032 predicted 1262
4 SASI_Hs01_00209033 predicted 1881
5 SASI_Hs01_00209034 predicted 1819
6 SASI_Hs01_00209035 predicted 1284
7 SASI_Hs01_00209036 predicted 2069
8 SASI_Hs01_00209037 predicted 1459
9 SASI_Hs01_00209038 predicted 1919
10 SASI_Hs01_00209039 predicted 1483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003978 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198083 predicted 2166
2 SASI_Rn01_00117165 predicted 1866
3 SASI_Rn01_00117166 predicted 1241
4 SASI_Rn01_00117167 predicted 567
5 SASI_Rn01_00117168 predicted 801
6 SASI_Rn01_00117170 predicted 1776
7 SASI_Rn01_00117172 predicted 1300
8 SASI_Rn02_00198084 predicted 1310
9 SASI_Rn01_00117173 predicted 2098
10 SASI_Rn02_00198085 predicted 953
11 SASI_Rn01_00117169 predicted 1726
12 SASI_Rn01_00117171 predicted 1232
13 SASI_Rn01_00117174 predicted 1855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130008 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310828 predicted 2306
2 SASI_Mm02_00310829 predicted 2013
3 SASI_Mm02_00310830 predicted 1339
4 SASI_Mm02_00310831 predicted 1689
5 SASI_Mm02_00310832 predicted 1997
6 SASI_Mm02_00310833 predicted 1940
7 SASI_Mm02_00310834 predicted 1862
8 SASI_Mm02_00310835 predicted 1082
9 SASI_Mm02_00310836 predicted 960
10 SASI_Mm02_00310837 predicted 1750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042176 predicted 705
2 SASI_Mm01_00042177 predicted 2010
3 SASI_Mm01_00042178 predicted 951
4 SASI_Mm01_00042179 predicted 1343
5 SASI_Mm01_00042181 predicted 1692
6 SASI_Mm01_00042182 predicted 2001
7 SASI_Mm02_00341684 predicted 1947
8 SASI_Mm01_00042183 predicted 1086
9 SASI_Mm01_00042184 predicted 970
10 SASI_Mm02_00341685 predicted 1758
11 SASI_Mm01_00042175 predicted 1979
12 SASI_Mm01_00042180 predicted 1026
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002094
VALIDATED
GSPT1 MISSION shRNA Bacterial Glycerol Stock
G1 to S phase transition 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002094.1-1521s1c1
Sequence:CCGGGCCGAACTTCAATAGATCAGTCTCGAGACTGATCTATTGAAGTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002094.1-1819s1c1
Sequence:CCGGCGCACATTTGATGCCCAGATACTCGAGTATCTGGGCATCAAATGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002094.1-2165s1c1
Sequence:CCGGCCTGCACAATACTGTGAGGAACTCGAGTTCCTCACAGTATTGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002094.1-1691s1c1
Sequence:CCGGCCGATGATGTAGAGACTGATACTCGAGTATCAGTCTCTACATCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002094.1-1522s1c1
Sequence:CCGGCCGAACTTCAATAGATCAGTTCTCGAGAACTGATCTATTGAAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002094.3-1535s21c1
Sequence:CCGGGCCGAACTTCAATAGATCAGTCTCGAGACTGATCTATTGAAGTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002094.3-1705s21c1
Sequence:CCGGCCGATGATGTAGAGACTGATACTCGAGTATCAGTCTCTACATCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002094.3-2179s21c1
Sequence:CCGGCCTGCACAATACTGTGAGGAACTCGAGTTCCTCACAGTATTGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002094.3-1833s21c1
Sequence:CCGGCGCACATTTGATGCCCAGATACTCGAGTATCTGGGCATCAAATGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002094
VALIDATED
GSPT1 MISSION shRNA shRNA Plasmid DNA
G1 to S phase transition 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002094.1-1521s1c1
Sequence:CCGGGCCGAACTTCAATAGATCAGTCTCGAGACTGATCTATTGAAGTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002094.1-1819s1c1
Sequence:CCGGCGCACATTTGATGCCCAGATACTCGAGTATCTGGGCATCAAATGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002094.1-2165s1c1
Sequence:CCGGCCTGCACAATACTGTGAGGAACTCGAGTTCCTCACAGTATTGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002094.1-1691s1c1
Sequence:CCGGCCGATGATGTAGAGACTGATACTCGAGTATCAGTCTCTACATCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002094.1-1522s1c1
Sequence:CCGGCCGAACTTCAATAGATCAGTTCTCGAGAACTGATCTATTGAAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002094.3-1535s21c1
Sequence:CCGGGCCGAACTTCAATAGATCAGTCTCGAGACTGATCTATTGAAGTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002094.3-1705s21c1
Sequence:CCGGCCGATGATGTAGAGACTGATACTCGAGTATCAGTCTCTACATCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002094.3-2179s21c1
Sequence:CCGGCCTGCACAATACTGTGAGGAACTCGAGTTCCTCACAGTATTGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002094.3-1833s21c1
Sequence:CCGGCGCACATTTGATGCCCAGATACTCGAGTATCTGGGCATCAAATGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002094
VALIDATED
GSPT1 MISSION shRNA Lentiviral Transduction Particles
G1 to S phase transition 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002094.1-1521s1c1
Sequence:CCGGGCCGAACTTCAATAGATCAGTCTCGAGACTGATCTATTGAAGTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002094.1-1819s1c1
Sequence:CCGGCGCACATTTGATGCCCAGATACTCGAGTATCTGGGCATCAAATGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118017    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002094.1-2165s1c1
Sequence:CCGGCCTGCACAATACTGTGAGGAACTCGAGTTCCTCACAGTATTGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002094.1-1691s1c1
Sequence:CCGGCCGATGATGTAGAGACTGATACTCGAGTATCAGTCTCTACATCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002094.1-1522s1c1
Sequence:CCGGCCGAACTTCAATAGATCAGTTCTCGAGAACTGATCTATTGAAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002094.3-1535s21c1
Sequence:CCGGGCCGAACTTCAATAGATCAGTCTCGAGACTGATCTATTGAAGTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002094.3-1705s21c1
Sequence:CCGGCCGATGATGTAGAGACTGATACTCGAGTATCAGTCTCTACATCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002094.3-2179s21c1
Sequence:CCGGCCTGCACAATACTGTGAGGAACTCGAGTTCCTCACAGTATTGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002094.3-1833s21c1
Sequence:CCGGCGCACATTTGATGCCCAGATACTCGAGTATCTGGGCATCAAATGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146066
VALIDATED
GSPT1 MISSION shRNA Bacterial Glycerol Stock
G1 to S phase transition 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146066.1-2118s1c1
Sequence:CCGGCCTTTCAAACTTCGCTTCCTTCTCGAGAAGGAAGCGAAGTTTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146066.1-1038s1c1
Sequence:CCGGGCAGGTGTCAAACACTTAATTCTCGAGAATTAAGTGTTTGACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146066.1-618s1c1
Sequence:CCGGCCCAAGAAGGAACATGTAAATCTCGAGATTTACATGTTCCTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146066.1-1099s1c1
Sequence:CCGGGCAACGAGAGATATGAAGAATCTCGAGATTCTTCATATCTCTCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146066.1-1663s1c1
Sequence:CCGGCCTGTATCGAAGAAGTCGAAACTCGAGTTTCGACTTCTTCGATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146066.2-1367s21c1
Sequence:CCGGGCAGGTGTCAAACACTTAATTCTCGAGAATTAAGTGTTTGACACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146066.2-947s21c1
Sequence:CCGGCCCAAGAAGGAACATGTAAATCTCGAGATTTACATGTTCCTTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146066.2-1992s21c1
Sequence:CCGGCCTGTATCGAAGAAGTCGAAACTCGAGTTTCGACTTCTTCGATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146066.2-1428s21c1
Sequence:CCGGGCAACGAGAGATATGAAGAATCTCGAGATTCTTCATATCTCTCGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146066
VALIDATED
GSPT1 MISSION shRNA shRNA Plasmid DNA
G1 to S phase transition 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146066.1-2118s1c1
Sequence:CCGGCCTTTCAAACTTCGCTTCCTTCTCGAGAAGGAAGCGAAGTTTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146066.1-1038s1c1
Sequence:CCGGGCAGGTGTCAAACACTTAATTCTCGAGAATTAAGTGTTTGACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146066.1-618s1c1
Sequence:CCGGCCCAAGAAGGAACATGTAAATCTCGAGATTTACATGTTCCTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146066.1-1099s1c1
Sequence:CCGGGCAACGAGAGATATGAAGAATCTCGAGATTCTTCATATCTCTCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146066.1-1663s1c1
Sequence:CCGGCCTGTATCGAAGAAGTCGAAACTCGAGTTTCGACTTCTTCGATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146066.2-1367s21c1
Sequence:CCGGGCAGGTGTCAAACACTTAATTCTCGAGAATTAAGTGTTTGACACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146066.2-947s21c1
Sequence:CCGGCCCAAGAAGGAACATGTAAATCTCGAGATTTACATGTTCCTTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146066.2-1992s21c1
Sequence:CCGGCCTGTATCGAAGAAGTCGAAACTCGAGTTTCGACTTCTTCGATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146066.2-1428s21c1
Sequence:CCGGGCAACGAGAGATATGAAGAATCTCGAGATTCTTCATATCTCTCGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146066
VALIDATED
GSPT1 MISSION shRNA Lentiviral Transduction Particles
G1 to S phase transition 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146066.1-2118s1c1
Sequence:CCGGCCTTTCAAACTTCGCTTCCTTCTCGAGAAGGAAGCGAAGTTTGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146066.1-1038s1c1
Sequence:CCGGGCAGGTGTCAAACACTTAATTCTCGAGAATTAAGTGTTTGACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146066.1-618s1c1
Sequence:CCGGCCCAAGAAGGAACATGTAAATCTCGAGATTTACATGTTCCTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146066.1-1099s1c1
Sequence:CCGGGCAACGAGAGATATGAAGAATCTCGAGATTCTTCATATCTCTCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146066.1-1663s1c1
Sequence:CCGGCCTGTATCGAAGAAGTCGAAACTCGAGTTTCGACTTCTTCGATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146066.2-1367s21c1
Sequence:CCGGGCAGGTGTCAAACACTTAATTCTCGAGAATTAAGTGTTTGACACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146066.2-947s21c1
Sequence:CCGGCCCAAGAAGGAACATGTAAATCTCGAGATTTACATGTTCCTTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146066.2-1992s21c1
Sequence:CCGGCCTGTATCGAAGAAGTCGAAACTCGAGTTTCGACTTCTTCGATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146066.2-1428s21c1
Sequence:CCGGGCAACGAGAGATATGAAGAATCTCGAGATTCTTCATATCTCTCGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)