EMAIL THIS PAGE TO A FRIEND

GSPT2

G1 to S phase transition 2

80 Gene Product Result for
Synonyms: ERF3B GST2
UniProtKB ID: Q8IYD1, Q9H909, Q9NVY0, Q9NY44
Gene ID:
Human(23708) Summary: This gene encodes a GTPase that belongs to the GTP-binding elongation factor family. The encoded protein is a polypeptide release factor that complexes with eukaryotic peptide chain release factor 1 to mediate translation termination. This protein may also be involved in mRNA stability.[provided by RefSeq, Mar 2010]
Mouse(14853) G1 to S phase transition 2
Rat(501582) G1 to S phase transition 2
dog(480921) G1 to S phase transition 2
cow(538724) G1 to S phase transition 2
Horse(100060648) G1 to S phase transition 2
naked mole-rat(101700668) G1 to S phase transition 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008179 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008179 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008179 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018094 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018094 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018094 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018094 Rosetta Predictions human pricing
NM_001109319 Rosetta Predictions rat pricing
NM_008179 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053905 predicted 945
2 SASI_Hs01_00053906 predicted 1735
3 SASI_Hs01_00053907 predicted 1832
4 SASI_Hs01_00053908 predicted 788
5 SASI_Hs01_00053909 predicted 1536
6 SASI_Hs01_00053910 predicted 1394
7 SASI_Hs01_00053911 predicted 1417
8 SASI_Hs01_00053913 predicted 1845
9 SASI_Hs01_00053914 predicted 1439
10 SASI_Hs02_00351277 predicted 1418
11 SASI_Hs01_00053912 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247254 predicted 1636
2 SASI_Rn02_00247255 predicted 1509
3 SASI_Rn02_00247256 predicted 1070
4 SASI_Rn02_00247257 predicted 922
5 SASI_Rn02_00247258 predicted 1710
6 SASI_Rn02_00247259 predicted 1886
7 SASI_Rn02_00247260 predicted 670
8 SASI_Rn02_00247261 predicted 1616
9 SASI_Rn02_00247262 predicted 2153
10 SASI_Rn02_00247263 predicted 1579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135593 predicted 1486
2 SASI_Mm01_00135595 predicted 1717
3 SASI_Mm01_00135596 predicted 1838
4 SASI_Mm01_00135597 predicted 1112
5 SASI_Mm01_00135598 predicted 2107
6 SASI_Mm02_00313310 predicted 1437
7 SASI_Mm01_00135599 predicted 1345
8 SASI_Mm01_00135600 predicted 580
9 SASI_Mm01_00135602 predicted 716
10 SASI_Mm02_00313311 predicted 1104
11 SASI_Mm01_00135594 predicted 341
12 SASI_Mm01_00135601 predicted 1800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008179
VALIDATED
GSPT2 MISSION shRNA Bacterial Glycerol Stock
G1 to S phase transition 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1723s21c1
Sequence:CCGGTACTTTGTGAACCCAGTAATCCTCGAGGATTACTGGGTTCACAAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1101s21c1
Sequence:CCGGGGTGCCTCTCAAGCCGATTTACTCGAGTAAATCGGCTTGAGAGGCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-795s21c1
Sequence:CCGGCCTAAGAAAGAACACGTAAATCTCGAGATTTACGTGTTCTTTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1270s21c1
Sequence:CCGGATTGGAGCAGTGAGCGATATGCTCGAGCATATCGCTCACTGCTCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1768s21c1
Sequence:CCGGATGTTCAGATAGTGATCATTGCTCGAGCAATGATCACTATCTGAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1420s21c1
Sequence:CCGGGGTACACCGGATTACCATTTACTCGAGTAAATGGTAATCCGGTGTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-645s21c1
Sequence:CCGGGAAGAATCTTGGGAGCTTAAACTCGAGTTTAAGCTCCCAAGATTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008179.2-2098s21c1
Sequence:CCGGTTGATGCCTCTGCACCATAATCTCGAGATTATGGTGCAGAGGCATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008179.2-963s1c1
Sequence:CCGGGCCTTAGATACAAACCAGGAACTCGAGTTCCTGGTTTGTATCTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008179.2-1372s1c1
Sequence:CCGGCAGGACTGACTGGAGCAAATACTCGAGTATTTGCTCCAGTCAGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008179.2-2174s1c1
Sequence:CCGGGCAGAGAAATTTCACAGCAAACTCGAGTTTGCTGTGAAATTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008179.2-1427s1c1
Sequence:CCGGCGGATTACCATTTATTCCGTACTCGAGTACGGAATAAATGGTAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008179.2-528s1c1
Sequence:CCGGGCACCTGTAGAACCTTCCAAACTCGAGTTTGGAAGGTTCTACAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008179
VALIDATED
GSPT2 MISSION shRNA shRNA Plasmid DNA
G1 to S phase transition 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1723s21c1
Sequence:CCGGTACTTTGTGAACCCAGTAATCCTCGAGGATTACTGGGTTCACAAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1101s21c1
Sequence:CCGGGGTGCCTCTCAAGCCGATTTACTCGAGTAAATCGGCTTGAGAGGCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-795s21c1
Sequence:CCGGCCTAAGAAAGAACACGTAAATCTCGAGATTTACGTGTTCTTTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1270s21c1
Sequence:CCGGATTGGAGCAGTGAGCGATATGCTCGAGCATATCGCTCACTGCTCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1768s21c1
Sequence:CCGGATGTTCAGATAGTGATCATTGCTCGAGCAATGATCACTATCTGAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1420s21c1
Sequence:CCGGGGTACACCGGATTACCATTTACTCGAGTAAATGGTAATCCGGTGTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-645s21c1
Sequence:CCGGGAAGAATCTTGGGAGCTTAAACTCGAGTTTAAGCTCCCAAGATTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008179.2-2098s21c1
Sequence:CCGGTTGATGCCTCTGCACCATAATCTCGAGATTATGGTGCAGAGGCATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008179.2-963s1c1
Sequence:CCGGGCCTTAGATACAAACCAGGAACTCGAGTTCCTGGTTTGTATCTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008179.2-1372s1c1
Sequence:CCGGCAGGACTGACTGGAGCAAATACTCGAGTATTTGCTCCAGTCAGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008179.2-2174s1c1
Sequence:CCGGGCAGAGAAATTTCACAGCAAACTCGAGTTTGCTGTGAAATTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008179.2-1427s1c1
Sequence:CCGGCGGATTACCATTTATTCCGTACTCGAGTACGGAATAAATGGTAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008179.2-528s1c1
Sequence:CCGGGCACCTGTAGAACCTTCCAAACTCGAGTTTGGAAGGTTCTACAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008179
VALIDATED
GSPT2 MISSION shRNA Lentiviral Transduction Particles
G1 to S phase transition 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1723s21c1
Sequence:CCGGTACTTTGTGAACCCAGTAATCCTCGAGGATTACTGGGTTCACAAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1101s21c1
Sequence:CCGGGGTGCCTCTCAAGCCGATTTACTCGAGTAAATCGGCTTGAGAGGCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-795s21c1
Sequence:CCGGCCTAAGAAAGAACACGTAAATCTCGAGATTTACGTGTTCTTTCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1270s21c1
Sequence:CCGGATTGGAGCAGTGAGCGATATGCTCGAGCATATCGCTCACTGCTCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1768s21c1
Sequence:CCGGATGTTCAGATAGTGATCATTGCTCGAGCAATGATCACTATCTGAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-1420s21c1
Sequence:CCGGGGTACACCGGATTACCATTTACTCGAGTAAATGGTAATCCGGTGTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008179.2-645s21c1
Sequence:CCGGGAAGAATCTTGGGAGCTTAAACTCGAGTTTAAGCTCCCAAGATTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008179.2-2098s21c1
Sequence:CCGGTTGATGCCTCTGCACCATAATCTCGAGATTATGGTGCAGAGGCATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008179.2-963s1c1
Sequence:CCGGGCCTTAGATACAAACCAGGAACTCGAGTTCCTGGTTTGTATCTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008179.2-1372s1c1
Sequence:CCGGCAGGACTGACTGGAGCAAATACTCGAGTATTTGCTCCAGTCAGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087863    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008179.2-2174s1c1
Sequence:CCGGGCAGAGAAATTTCACAGCAAACTCGAGTTTGCTGTGAAATTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008179.2-1427s1c1
Sequence:CCGGCGGATTACCATTTATTCCGTACTCGAGTACGGAATAAATGGTAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008179.2-528s1c1
Sequence:CCGGGCACCTGTAGAACCTTCCAAACTCGAGTTTGGAAGGTTCTACAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018094
GSPT2 MISSION shRNA Bacterial Glycerol Stock
G1 to S phase transition 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018094.3-2333s21c1
Sequence:CCGGCCTTGGACAATATCAGTAATACTCGAGTATTACTGATATTGTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018094.3-1487s21c1
Sequence:CCGGCCAAACTTCAACAGATCAATTCTCGAGAATTGATCTGTTGAAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018094.3-1784s21c1
Sequence:CCGGCGCACGTTTGATGTTCAGATACTCGAGTATCTGAACATCAAACGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018094.3-818s21c1
Sequence:CCGGGCACCTAAGAAAGAACACGTACTCGAGTACGTGTTCTTTCTTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018094.2-2303s1c1
Sequence:CCGGCCTTGGACAATATCAGTAATACTCGAGTATTACTGATATTGTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018094.2-788s1c1
Sequence:CCGGGCACCTAAGAAAGAACACGTACTCGAGTACGTGTTCTTTCTTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018094.2-1457s1c1
Sequence:CCGGCCAAACTTCAACAGATCAATTCTCGAGAATTGATCTGTTGAAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018094.2-1754s1c1
Sequence:CCGGCGCACGTTTGATGTTCAGATACTCGAGTATCTGAACATCAAACGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018094
GSPT2 MISSION shRNA shRNA Plasmid DNA
G1 to S phase transition 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018094.3-2333s21c1
Sequence:CCGGCCTTGGACAATATCAGTAATACTCGAGTATTACTGATATTGTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018094.3-1487s21c1
Sequence:CCGGCCAAACTTCAACAGATCAATTCTCGAGAATTGATCTGTTGAAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018094.3-1784s21c1
Sequence:CCGGCGCACGTTTGATGTTCAGATACTCGAGTATCTGAACATCAAACGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018094.3-818s21c1
Sequence:CCGGGCACCTAAGAAAGAACACGTACTCGAGTACGTGTTCTTTCTTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018094.2-2303s1c1
Sequence:CCGGCCTTGGACAATATCAGTAATACTCGAGTATTACTGATATTGTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018094.2-788s1c1
Sequence:CCGGGCACCTAAGAAAGAACACGTACTCGAGTACGTGTTCTTTCTTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018094.2-1457s1c1
Sequence:CCGGCCAAACTTCAACAGATCAATTCTCGAGAATTGATCTGTTGAAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018094.2-1754s1c1
Sequence:CCGGCGCACGTTTGATGTTCAGATACTCGAGTATCTGAACATCAAACGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018094
GSPT2 MISSION shRNA Lentiviral Transduction Particles
G1 to S phase transition 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018094.3-2333s21c1
Sequence:CCGGCCTTGGACAATATCAGTAATACTCGAGTATTACTGATATTGTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018094.3-1487s21c1
Sequence:CCGGCCAAACTTCAACAGATCAATTCTCGAGAATTGATCTGTTGAAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018094.3-1784s21c1
Sequence:CCGGCGCACGTTTGATGTTCAGATACTCGAGTATCTGAACATCAAACGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018094.3-818s21c1
Sequence:CCGGGCACCTAAGAAAGAACACGTACTCGAGTACGTGTTCTTTCTTAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118082    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018094.2-2303s1c1
Sequence:CCGGCCTTGGACAATATCAGTAATACTCGAGTATTACTGATATTGTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018094.2-788s1c1
Sequence:CCGGGCACCTAAGAAAGAACACGTACTCGAGTACGTGTTCTTTCTTAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018094.2-1457s1c1
Sequence:CCGGCCAAACTTCAACAGATCAATTCTCGAGAATTGATCTGTTGAAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018094.2-1754s1c1
Sequence:CCGGCGCACGTTTGATGTTCAGATACTCGAGTATCTGAACATCAAACGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)