EMAIL THIS PAGE TO A FRIEND

GSR

glutathione reductase

65 Gene Product Result for
Gene ID:
Human(2936) Summary: This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. This enzyme is a homodimeric flavoprotein. It is a central enzyme of cellular antioxidant defense, and reduces oxidized glutathione disulfide (GSSG) to the sulfhydryl form GSH, which is an important cellular antioxidant. Rare mutations in this gene result in hereditary glutathione reductase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Aug 2010]
Mouse(14782) glutathione reductase
Rat(116686) glutathione reductase
sheep(101114416) glutathione reductase
domestic guinea pig(100718789) glutathione reductase
naked mole-rat(101696661) glutathione reductase
Zebrafish(553575) glutathione reductase
chicken(771783) glutathione reductase
cow(506406) glutathione reductase
domestic cat(101094413) glutathione reductase
dog(475596) glutathione reductase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M9140 Methylene blue certified by the Biological Stain Commission human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C0400 Carmustine ≥98% human pricing

Activity Assay

Product # Description Species Add to Cart
 
CS0260 Glutathione Assay Kit sufficient for 700 assays human pricing

Kits

Product # Description Species Add to Cart
 
GRSA Glutathione Reductase Assay Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000637 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000637 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000637 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000637 Rosetta Predictions human pricing
NM_053906 Rosetta Predictions rat pricing
NM_010344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000637 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152913 predicted 1365
2 SASI_Hs01_00152914 predicted 493
3 SASI_Hs02_00302987 predicted 1609
4 SASI_Hs01_00152916 predicted 543
5 SASI_Hs01_00152917 predicted 1410
6 SASI_Hs01_00152918 predicted 1147
7 SASI_Hs01_00152919 predicted 1226
8 SASI_Hs01_00152920 predicted 1293
9 SASI_Hs01_00152921 predicted 736
10 SASI_Hs02_00302988 predicted 446
11 SASI_Hs01_00152915 predicted 487
12 SASI_Hs01_00152922 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053906 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039082 predicted 546
2 SASI_Rn01_00039083 predicted 1023
3 SASI_Rn01_00039084 predicted 921
4 SASI_Rn01_00039085 predicted 243
5 SASI_Rn01_00039086 predicted 610
6 SASI_Rn01_00039087 predicted 871
7 SASI_Rn01_00039088 predicted 629
8 SASI_Rn02_00266837 predicted 661
9 SASI_Rn01_00039090 predicted 1053
10 SASI_Rn02_00266838 predicted 221
11 SASI_Rn01_00039089 predicted 740
12 SASI_Rn01_00039091 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111263 predicted 1007
2 SASI_Mm01_00111264 predicted 722
3 SASI_Mm01_00111265 predicted 1306
4 SASI_Mm01_00111266 predicted 1411
5 SASI_Mm01_00111267 predicted 1015
6 SASI_Mm02_00318359 predicted 1520
7 SASI_Mm01_00111268 predicted 1426
8 SASI_Mm01_00111269 predicted 1106
9 SASI_Mm01_00111270 predicted 1528
10 SASI_Mm02_00318360 predicted 1508
11 SASI_Mm01_00111271 predicted 1762
12 SASI_Mm01_00111272 predicted 1403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000637
VALIDATED
GSR MISSION shRNA Bacterial Glycerol Stock
glutathione reductase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000637.1-1255s1c1
Sequence:CCGGCGGAAGATGAAGCCATTCATACTCGAGTATGAATGGCTTCATCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000637.1-432s1c1
Sequence:CCGGCGCCTGAATGCCATCTATCAACTCGAGTTGATAGATGGCATTCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000637.1-1297s1c1
Sequence:CCGGAGACCTATTCAACGAGCTTTACTCGAGTAAAGCTCGTTGAATAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000637.1-1028s1c1
Sequence:CCGGCGATGACAAGGGTCATATCATCTCGAGATGATATGACCCTTGTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000637.1-748s1c1
Sequence:CCGGCACTGATGATACGGCATGATACTCGAGTATCATGCCGTATCATCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000637
VALIDATED
GSR MISSION shRNA shRNA Plasmid DNA
glutathione reductase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000637.1-1255s1c1
Sequence:CCGGCGGAAGATGAAGCCATTCATACTCGAGTATGAATGGCTTCATCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000637.1-432s1c1
Sequence:CCGGCGCCTGAATGCCATCTATCAACTCGAGTTGATAGATGGCATTCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000637.1-1297s1c1
Sequence:CCGGAGACCTATTCAACGAGCTTTACTCGAGTAAAGCTCGTTGAATAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000637.1-1028s1c1
Sequence:CCGGCGATGACAAGGGTCATATCATCTCGAGATGATATGACCCTTGTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000637.1-748s1c1
Sequence:CCGGCACTGATGATACGGCATGATACTCGAGTATCATGCCGTATCATCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000637
VALIDATED
GSR MISSION shRNA Lentiviral Transduction Particles
glutathione reductase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000637.1-1255s1c1
Sequence:CCGGCGGAAGATGAAGCCATTCATACTCGAGTATGAATGGCTTCATCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000637.1-432s1c1
Sequence:CCGGCGCCTGAATGCCATCTATCAACTCGAGTTGATAGATGGCATTCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000637.1-1297s1c1
Sequence:CCGGAGACCTATTCAACGAGCTTTACTCGAGTAAAGCTCGTTGAATAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000637.1-1028s1c1
Sequence:CCGGCGATGACAAGGGTCATATCATCTCGAGATGATATGACCCTTGTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000637.1-748s1c1
Sequence:CCGGCACTGATGATACGGCATGATACTCGAGTATCATGCCGTATCATCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010344
VALIDATED
GSR MISSION shRNA Bacterial Glycerol Stock
glutathione reductase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-1101s1c1
Sequence:CCGGGTGTTGAAGTTCACACAGGTTCTCGAGAACCTGTGTGAACTTCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-639s1c1
Sequence:CCGGGAGGGTAAATTCAGTTGGCATCTCGAGATGCCAACTGAATTTACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-693s1c1
Sequence:CCGGCGCCTGAACACCATCTATCAACTCGAGTTGATAGATGGTGTTCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-1527s1c1
Sequence:CCGGGCTGTTCATAAGTATGGGAAACTCGAGTTTCCCATACTTATGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-1244s1c1
Sequence:CCGGCCCAAATTCTAAGGGCCTGAACTCGAGTTCAGGCCCTTAGAATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010344.4-1527s21c1
Sequence:CCGGGCTGTTCATAAGTATGGGAAACTCGAGTTTCCCATACTTATGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010344.4-1101s21c1
Sequence:CCGGGTGTTGAAGTTCACACAGGTTCTCGAGAACCTGTGTGAACTTCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010344.4-639s21c1
Sequence:CCGGGAGGGTAAATTCAGTTGGCATCTCGAGATGCCAACTGAATTTACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010344.4-693s21c1
Sequence:CCGGCGCCTGAACACCATCTATCAACTCGAGTTGATAGATGGTGTTCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010344
VALIDATED
GSR MISSION shRNA shRNA Plasmid DNA
glutathione reductase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-1101s1c1
Sequence:CCGGGTGTTGAAGTTCACACAGGTTCTCGAGAACCTGTGTGAACTTCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-639s1c1
Sequence:CCGGGAGGGTAAATTCAGTTGGCATCTCGAGATGCCAACTGAATTTACCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-693s1c1
Sequence:CCGGCGCCTGAACACCATCTATCAACTCGAGTTGATAGATGGTGTTCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-1527s1c1
Sequence:CCGGGCTGTTCATAAGTATGGGAAACTCGAGTTTCCCATACTTATGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-1244s1c1
Sequence:CCGGCCCAAATTCTAAGGGCCTGAACTCGAGTTCAGGCCCTTAGAATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010344.4-1527s21c1
Sequence:CCGGGCTGTTCATAAGTATGGGAAACTCGAGTTTCCCATACTTATGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010344.4-1101s21c1
Sequence:CCGGGTGTTGAAGTTCACACAGGTTCTCGAGAACCTGTGTGAACTTCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010344.4-639s21c1
Sequence:CCGGGAGGGTAAATTCAGTTGGCATCTCGAGATGCCAACTGAATTTACCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010344.4-693s21c1
Sequence:CCGGCGCCTGAACACCATCTATCAACTCGAGTTGATAGATGGTGTTCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010344
VALIDATED
GSR MISSION shRNA Lentiviral Transduction Particles
glutathione reductase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-1101s1c1
Sequence:CCGGGTGTTGAAGTTCACACAGGTTCTCGAGAACCTGTGTGAACTTCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-639s1c1
Sequence:CCGGGAGGGTAAATTCAGTTGGCATCTCGAGATGCCAACTGAATTTACCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-693s1c1
Sequence:CCGGCGCCTGAACACCATCTATCAACTCGAGTTGATAGATGGTGTTCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-1527s1c1
Sequence:CCGGGCTGTTCATAAGTATGGGAAACTCGAGTTTCCCATACTTATGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010344.3-1244s1c1
Sequence:CCGGCCCAAATTCTAAGGGCCTGAACTCGAGTTCAGGCCCTTAGAATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010344.4-1527s21c1
Sequence:CCGGGCTGTTCATAAGTATGGGAAACTCGAGTTTCCCATACTTATGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010344.4-1101s21c1
Sequence:CCGGGTGTTGAAGTTCACACAGGTTCTCGAGAACCTGTGTGAACTTCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010344.4-639s21c1
Sequence:CCGGGAGGGTAAATTCAGTTGGCATCTCGAGATGCCAACTGAATTTACCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010344.4-693s21c1
Sequence:CCGGCGCCTGAACACCATCTATCAACTCGAGTTGATAGATGGTGTTCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)