EMAIL THIS PAGE TO A FRIEND

GSS

glutathione synthetase

59 Gene Product Result for
Synonyms: GSHS
UniProtKB ID: P48637, B2R697, B6F210, E1P5P9, Q4TTD9
Gene ID:
Human(2937) Summary: Glutathione is important for a variety of biological functions, including protection of cells from oxidative damage by free radicals, detoxification of xenobiotics, and membrane transport. The protein encoded by this gene functions as a homodimer to catalyze the second step of glutathione biosynthesis, which is the ATP-dependent conversion of gamma-L-glutamyl-L-cysteine to glutathione. Defects in this gene are a cause of glutathione synthetase deficiency. [provided by RefSeq, Jul 2008]
Mouse(14854) glutathione synthetase
Rat(25458) glutathione synthetase
Zebrafish(450084) glutathione synthetase
chicken(428135) glutathione synthetase
dog(442962) glutathione synthetase
domestic cat(101084439) glutathione synthetase
cow(525059) glutathione synthetase
Horse(100069411) glutathione synthetase
domestic guinea pig(100734620) glutathione synthetase
naked mole-rat(101704674) glutathione synthetase
sheep(101114544) glutathione synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008180 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008180 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008180 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000178 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055431 MISSION® esiRNA esiRNA human GSS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000178 Rosetta Predictions human pricing
NM_012962 Rosetta Predictions rat pricing
NM_008180 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137181 predicted 893
2 SASI_Hs01_00137182 predicted 445
3 SASI_Hs01_00137183 predicted 337
4 SASI_Hs01_00137184 predicted 1528
5 SASI_Hs01_00137186 predicted 776
6 SASI_Hs01_00137187 predicted 355
7 SASI_Hs01_00137188 predicted 371
8 SASI_Hs01_00137190 predicted 877
9 SASI_Hs02_00302018 predicted 909
10 SASI_Hs02_00302019 predicted 350
11 SASI_Hs01_00137185 predicted 569
12 SASI_Hs01_00137189 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067244 predicted 733
2 SASI_Rn01_00067245 predicted 1346
3 SASI_Rn01_00067246 predicted 476
4 SASI_Rn02_00260564 predicted 1332
5 SASI_Rn01_00067247 predicted 733
6 SASI_Rn01_00067248 predicted 408
7 SASI_Rn01_00067249 predicted 756
8 SASI_Rn01_00067250 predicted 1131
9 SASI_Rn01_00067251 predicted 463
10 SASI_Rn01_00067253 predicted 1488
11 SASI_Rn01_00067252 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121892 predicted 1306
2 SASI_Mm01_00121893 predicted 1324
3 SASI_Mm01_00121894 predicted 381
4 SASI_Mm01_00121895 predicted 617
5 SASI_Mm01_00121896 predicted 455
6 SASI_Mm01_00121898 predicted 1275
7 SASI_Mm01_00121899 predicted 543
8 SASI_Mm01_00121900 predicted 898
9 SASI_Mm01_00121901 predicted 279
10 SASI_Mm02_00313312 predicted 772
11 SASI_Mm01_00121897 predicted 928
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008180
VALIDATED
GSS MISSION shRNA Bacterial Glycerol Stock
glutathione synthetase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008180.1-524s21c1
Sequence:CCGGGTCCTGAATAAGACCAAAGAACTCGAGTTCTTTGGTCTTATTCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008180.1-321s21c1
Sequence:CCGGCCCGTCTCTTTGATATCTACACTCGAGTGTAGATATCAAAGAGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008180.1-1542s21c1
Sequence:CCGGTCTCTTCCATAGACCTCCAAACTCGAGTTTGGAGGTCTATGGAAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008180.1-436s21c1
Sequence:CCGGCCTGAAACAGATCGAGATCAACTCGAGTTGATCTCGATCTGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008180.1-1542s1c1
Sequence:CCGGTCTCTTCCATAGACCTCCAAACTCGAGTTTGGAGGTCTATGGAAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008180.1-524s1c1
Sequence:CCGGGTCCTGAATAAGACCAAAGAACTCGAGTTCTTTGGTCTTATTCAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008180.1-321s1c1
Sequence:CCGGCCCGTCTCTTTGATATCTACACTCGAGTGTAGATATCAAAGAGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008180.1-322s1c1
Sequence:CCGGCCGTCTCTTTGATATCTACAACTCGAGTTGTAGATATCAAAGAGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008180.1-436s1c1
Sequence:CCGGCCTGAAACAGATCGAGATCAACTCGAGTTGATCTCGATCTGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008180
VALIDATED
GSS MISSION shRNA shRNA Plasmid DNA
glutathione synthetase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008180.1-524s21c1
Sequence:CCGGGTCCTGAATAAGACCAAAGAACTCGAGTTCTTTGGTCTTATTCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008180.1-321s21c1
Sequence:CCGGCCCGTCTCTTTGATATCTACACTCGAGTGTAGATATCAAAGAGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008180.1-1542s21c1
Sequence:CCGGTCTCTTCCATAGACCTCCAAACTCGAGTTTGGAGGTCTATGGAAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008180.1-436s21c1
Sequence:CCGGCCTGAAACAGATCGAGATCAACTCGAGTTGATCTCGATCTGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008180.1-1542s1c1
Sequence:CCGGTCTCTTCCATAGACCTCCAAACTCGAGTTTGGAGGTCTATGGAAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008180.1-524s1c1
Sequence:CCGGGTCCTGAATAAGACCAAAGAACTCGAGTTCTTTGGTCTTATTCAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008180.1-321s1c1
Sequence:CCGGCCCGTCTCTTTGATATCTACACTCGAGTGTAGATATCAAAGAGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008180.1-322s1c1
Sequence:CCGGCCGTCTCTTTGATATCTACAACTCGAGTTGTAGATATCAAAGAGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008180.1-436s1c1
Sequence:CCGGCCTGAAACAGATCGAGATCAACTCGAGTTGATCTCGATCTGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008180
VALIDATED
GSS MISSION shRNA Lentiviral Transduction Particles
glutathione synthetase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008180.1-524s21c1
Sequence:CCGGGTCCTGAATAAGACCAAAGAACTCGAGTTCTTTGGTCTTATTCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008180.1-321s21c1
Sequence:CCGGCCCGTCTCTTTGATATCTACACTCGAGTGTAGATATCAAAGAGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008180.1-1542s21c1
Sequence:CCGGTCTCTTCCATAGACCTCCAAACTCGAGTTTGGAGGTCTATGGAAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008180.1-436s21c1
Sequence:CCGGCCTGAAACAGATCGAGATCAACTCGAGTTGATCTCGATCTGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008180.1-1542s1c1
Sequence:CCGGTCTCTTCCATAGACCTCCAAACTCGAGTTTGGAGGTCTATGGAAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008180.1-524s1c1
Sequence:CCGGGTCCTGAATAAGACCAAAGAACTCGAGTTCTTTGGTCTTATTCAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008180.1-321s1c1
Sequence:CCGGCCCGTCTCTTTGATATCTACACTCGAGTGTAGATATCAAAGAGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008180.1-322s1c1
Sequence:CCGGCCGTCTCTTTGATATCTACAACTCGAGTTGTAGATATCAAAGAGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008180.1-436s1c1
Sequence:CCGGCCTGAAACAGATCGAGATCAACTCGAGTTGATCTCGATCTGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000178
VALIDATED
GSS MISSION shRNA Bacterial Glycerol Stock
glutathione synthetase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000178.2-1185s21c1
Sequence:CCGGGGTGGAGGTAACAACCTATATCTCGAGATATAGGTTGTTACCTCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000178.2-606s21c1
Sequence:CCGGGCTGGCAAGATCCTCTCTAATCTCGAGATTAGAGAGGATCTTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000178.2-853s21c1
Sequence:CCGGGCCAGGAAATTGCTGTGGTTTCTCGAGAAACCACAGCAATTTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000178.2-358s21c1
Sequence:CCGGCCATCAAACAGGATGACTTTACTCGAGTAAAGTCATCCTGTTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000178.2-1524s21c1
Sequence:CCGGGGACCTTCTATCCTCTGTATTCTCGAGAATACAGAGGATAGAAGGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000178.2-853s1c1
Sequence:CCGGGCCAGGAAATTGCTGTGGTTTCTCGAGAAACCACAGCAATTTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000178.2-741s1c1
Sequence:CCGGCGTGCCATAGAGAATGAGCTACTCGAGTAGCTCATTCTCTATGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000178.2-606s1c1
Sequence:CCGGGCTGGCAAGATCCTCTCTAATCTCGAGATTAGAGAGGATCTTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000178.2-358s1c1
Sequence:CCGGCCATCAAACAGGATGACTTTACTCGAGTAAAGTCATCCTGTTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000178.2-785s1c1
Sequence:CCGGCCGACGAACATTTGAAGATATCTCGAGATATCTTCAAATGTTCGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000178
VALIDATED
GSS MISSION shRNA shRNA Plasmid DNA
glutathione synthetase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000178.2-1185s21c1
Sequence:CCGGGGTGGAGGTAACAACCTATATCTCGAGATATAGGTTGTTACCTCCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000178.2-606s21c1
Sequence:CCGGGCTGGCAAGATCCTCTCTAATCTCGAGATTAGAGAGGATCTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000178.2-853s21c1
Sequence:CCGGGCCAGGAAATTGCTGTGGTTTCTCGAGAAACCACAGCAATTTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000178.2-358s21c1
Sequence:CCGGCCATCAAACAGGATGACTTTACTCGAGTAAAGTCATCCTGTTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000178.2-1524s21c1
Sequence:CCGGGGACCTTCTATCCTCTGTATTCTCGAGAATACAGAGGATAGAAGGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000178.2-853s1c1
Sequence:CCGGGCCAGGAAATTGCTGTGGTTTCTCGAGAAACCACAGCAATTTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000178.2-741s1c1
Sequence:CCGGCGTGCCATAGAGAATGAGCTACTCGAGTAGCTCATTCTCTATGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000178.2-606s1c1
Sequence:CCGGGCTGGCAAGATCCTCTCTAATCTCGAGATTAGAGAGGATCTTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000178.2-358s1c1
Sequence:CCGGCCATCAAACAGGATGACTTTACTCGAGTAAAGTCATCCTGTTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000178.2-785s1c1
Sequence:CCGGCCGACGAACATTTGAAGATATCTCGAGATATCTTCAAATGTTCGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000178
VALIDATED
GSS MISSION shRNA Lentiviral Transduction Particles
glutathione synthetase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000178.2-1185s21c1
Sequence:CCGGGGTGGAGGTAACAACCTATATCTCGAGATATAGGTTGTTACCTCCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_000178.2-606s21c1
Sequence:CCGGGCTGGCAAGATCCTCTCTAATCTCGAGATTAGAGAGGATCTTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000178.2-853s21c1
Sequence:CCGGGCCAGGAAATTGCTGTGGTTTCTCGAGAAACCACAGCAATTTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000178.2-358s21c1
Sequence:CCGGCCATCAAACAGGATGACTTTACTCGAGTAAAGTCATCCTGTTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293634    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000178.2-1524s21c1
Sequence:CCGGGGACCTTCTATCCTCTGTATTCTCGAGAATACAGAGGATAGAAGGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000178.2-853s1c1
Sequence:CCGGGCCAGGAAATTGCTGTGGTTTCTCGAGAAACCACAGCAATTTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000178.2-741s1c1
Sequence:CCGGCGTGCCATAGAGAATGAGCTACTCGAGTAGCTCATTCTCTATGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_000178.2-606s1c1
Sequence:CCGGGCTGGCAAGATCCTCTCTAATCTCGAGATTAGAGAGGATCTTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000178.2-358s1c1
Sequence:CCGGCCATCAAACAGGATGACTTTACTCGAGTAAAGTCATCCTGTTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_000178.2-785s1c1
Sequence:CCGGCCGACGAACATTTGAAGATATCTCGAGATATCTTCAAATGTTCGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)