EMAIL THIS PAGE TO A FRIEND

GSTA1

glutathione S-transferase alpha 1

33 Gene Product Result for
Synonyms: GST2 GSTA1-1 GTH1
Species: Human GSTA1(2938), Mouse Gsta1(14857), sheep GSTA1(100141301), domestic guinea pig Gsta1(100713029), naked mole-rat Gsta1(101714852)
UniProtKB ID: P08263, Q14750, Q5GHF8, Q5SZC1
Gene ID:
Human(2938) Summary: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes function in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding these enzymes are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of some drugs. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class. The alpha class genes, located in a cluster mapped to chromosome 6, are the most abundantly expressed glutathione S-transferases in liver. In addition to metabolizing bilirubin and certain anti-cancer drugs in the liver, the alpha class of these enzymes exhibit glutathione peroxidase activity thereby protecting the cells from reactive oxygen species and the products of peroxidation. [provided by RefSeq, Jul 2008]
Mouse(14857) glutathione S-transferase, alpha 1 (Ya)
sheep(100141301) glutathione S-transferase alpha 1
domestic guinea pig(100713029) glutathione S-transferase alpha 1
naked mole-rat(101714852) glutathione S-transferase alpha 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS60 GST A1-1, Recombinant Human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008181 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008181 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008181 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145740 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
12-350 GST GST primarily used in Western Blotting. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145740 Rosetta Predictions human pricing
NM_008181 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020252 predicted 792
2 SASI_Hs01_00020253 predicted 798
3 SASI_Hs01_00020254 predicted 433
4 SASI_Hs01_00020257 predicted 589
5 SASI_Hs01_00020255 predicted 789
6 SASI_Hs01_00020258 predicted 817
7 SASI_Hs01_00020256 predicted 788
8 SASI_Hs01_00020259 predicted 771
9 SASI_Hs01_00020260 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059662 predicted 553
2 SASI_Mm01_00059663 predicted 547
3 SASI_Mm01_00059664 predicted 732
4 SASI_Mm01_00059665 predicted 737
5 SASI_Mm01_00059661 predicted 560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008181
VALIDATED
GSTA1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase alpha 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-557s1c1
Sequence:CCGGCTCCTCTATGTTGAAGAGTTTCTCGAGAAACTCTTCAACATAGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-706s1c1
Sequence:CCGGTCAAGAAGCAAGGAAGGCTTTCTCGAGAAAGCCTTCCTTGCTTCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-569s1c1
Sequence:CCGGGAAGAGTTTGATGCCAGCCTTCTCGAGAAGGCTGGCATCAAACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-281s1c1
Sequence:CCGGCTCAACTACATCGCCACCAAACTCGAGTTTGGTGGCGATGTAGTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-406s1c1
Sequence:CCGGCCCAGACCAAAGAGAAGCCAACTCGAGTTGGCTTCTCTTTGGTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-362s21c1
Sequence:CCGGACATGTATTCAGAAGGTATTTCTCGAGAAATACCTTCTGAATACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-397s21c1
Sequence:CCGGATGATTGGGCAATTGGTATTACTCGAGTAATACCAATTGCCCAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008181.3-169s21c1
Sequence:CCGGGAGTTTGAAGAGAAGTTTATACTCGAGTATAAACTTCTCTTCAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-311s21c1
Sequence:CCGGCCACCAAATATGACCTCTATGCTCGAGCATAGAGGTCATATTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-519s21c1
Sequence:CCGGAGACTACCTTGTGGGCAACAGCTCGAGCTGTTGCCCACAAGGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008181.3-191s21c1
Sequence:CCGGAGAGTCCGGAAGATTTGGAAACTCGAGTTTCCAAATCTTCCGGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-223s21c1
Sequence:CCGGGATGGGAATTTGATGTTTGACCTCGAGGTCAAACATCAAATTCCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-248s21c1
Sequence:CCGGTGCCCATGGTGGAGATTGATGCTCGAGCATCAATCTCCACCATGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-473s21c1
Sequence:CCGGACCGTTACTTGCCTGCCTTTGCTCGAGCAAAGGCAGGCAAGTAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008181
VALIDATED
GSTA1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase alpha 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-557s1c1
Sequence:CCGGCTCCTCTATGTTGAAGAGTTTCTCGAGAAACTCTTCAACATAGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-706s1c1
Sequence:CCGGTCAAGAAGCAAGGAAGGCTTTCTCGAGAAAGCCTTCCTTGCTTCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-569s1c1
Sequence:CCGGGAAGAGTTTGATGCCAGCCTTCTCGAGAAGGCTGGCATCAAACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-281s1c1
Sequence:CCGGCTCAACTACATCGCCACCAAACTCGAGTTTGGTGGCGATGTAGTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-406s1c1
Sequence:CCGGCCCAGACCAAAGAGAAGCCAACTCGAGTTGGCTTCTCTTTGGTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-362s21c1
Sequence:CCGGACATGTATTCAGAAGGTATTTCTCGAGAAATACCTTCTGAATACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-397s21c1
Sequence:CCGGATGATTGGGCAATTGGTATTACTCGAGTAATACCAATTGCCCAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008181.3-169s21c1
Sequence:CCGGGAGTTTGAAGAGAAGTTTATACTCGAGTATAAACTTCTCTTCAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-311s21c1
Sequence:CCGGCCACCAAATATGACCTCTATGCTCGAGCATAGAGGTCATATTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-519s21c1
Sequence:CCGGAGACTACCTTGTGGGCAACAGCTCGAGCTGTTGCCCACAAGGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008181.3-191s21c1
Sequence:CCGGAGAGTCCGGAAGATTTGGAAACTCGAGTTTCCAAATCTTCCGGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-223s21c1
Sequence:CCGGGATGGGAATTTGATGTTTGACCTCGAGGTCAAACATCAAATTCCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-248s21c1
Sequence:CCGGTGCCCATGGTGGAGATTGATGCTCGAGCATCAATCTCCACCATGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-473s21c1
Sequence:CCGGACCGTTACTTGCCTGCCTTTGCTCGAGCAAAGGCAGGCAAGTAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008181
VALIDATED
GSTA1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase alpha 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-557s1c1
Sequence:CCGGCTCCTCTATGTTGAAGAGTTTCTCGAGAAACTCTTCAACATAGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-706s1c1
Sequence:CCGGTCAAGAAGCAAGGAAGGCTTTCTCGAGAAAGCCTTCCTTGCTTCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-569s1c1
Sequence:CCGGGAAGAGTTTGATGCCAGCCTTCTCGAGAAGGCTGGCATCAAACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-281s1c1
Sequence:CCGGCTCAACTACATCGCCACCAAACTCGAGTTTGGTGGCGATGTAGTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008181.2-406s1c1
Sequence:CCGGCCCAGACCAAAGAGAAGCCAACTCGAGTTGGCTTCTCTTTGGTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-362s21c1
Sequence:CCGGACATGTATTCAGAAGGTATTTCTCGAGAAATACCTTCTGAATACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-397s21c1
Sequence:CCGGATGATTGGGCAATTGGTATTACTCGAGTAATACCAATTGCCCAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008181.3-169s21c1
Sequence:CCGGGAGTTTGAAGAGAAGTTTATACTCGAGTATAAACTTCTCTTCAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-311s21c1
Sequence:CCGGCCACCAAATATGACCTCTATGCTCGAGCATAGAGGTCATATTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-519s21c1
Sequence:CCGGAGACTACCTTGTGGGCAACAGCTCGAGCTGTTGCCCACAAGGTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_008181.3-191s21c1
Sequence:CCGGAGAGTCCGGAAGATTTGGAAACTCGAGTTTCCAAATCTTCCGGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-223s21c1
Sequence:CCGGGATGGGAATTTGATGTTTGACCTCGAGGTCAAACATCAAATTCCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-248s21c1
Sequence:CCGGTGCCCATGGTGGAGATTGATGCTCGAGCATCAATCTCCACCATGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008181.3-473s21c1
Sequence:CCGGACCGTTACTTGCCTGCCTTTGCTCGAGCAAAGGCAGGCAAGTAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145740
GSTA1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase alpha 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-162s1c1
Sequence:CCGGGCAGCTGGAGTAGAGTTTGAACTCGAGTTCAAACTCTACTCCAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-248s1c1
Sequence:CCGGGCAAGTGCCAATGGTTGAGATCTCGAGATCTCAACCATTGGCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-326s1c1
Sequence:CCGGCAACCTCTATGGGAAAGACATCTCGAGATGTCTTTCCCATAGAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-449s1c1
Sequence:CCGGGCTTGCCTTGATCAAAGAGAACTCGAGTTCTCTTTGATCAAGGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-444s1c1
Sequence:CCGGGCCAAGCTTGCCTTGATCAAACTCGAGTTTGATCAAGGCAAGCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-516s1c1
Sequence:CCGGCATGGACAAGACTACCTTGTTCTCGAGAACAAGGTAGTCTTGTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-481s1c1
Sequence:CCGGGCTACTTCCCTGCCTTTGAAACTCGAGTTTCAAAGGCAGGGAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-169s1c1
Sequence:CCGGGAGTAGAGTTTGAAGAGAAATCTCGAGATTTCTCTTCAAACTCTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145740.3-919s21c1
Sequence:CCGGACAACTCCTATTCGCTGACTTCTCGAGAAGTCAGCGAATAGGAGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145740.3-803s21c1
Sequence:CCGGGAACTTGCAATACCAATGTTCCTCGAGGAACATTGGTATTGCAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145740.3-1082s21c1
Sequence:CCGGTGTCCCGTAACATACAATTTGCTCGAGCAAATTGTATGTTACGGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145740
GSTA1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase alpha 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-162s1c1
Sequence:CCGGGCAGCTGGAGTAGAGTTTGAACTCGAGTTCAAACTCTACTCCAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-248s1c1
Sequence:CCGGGCAAGTGCCAATGGTTGAGATCTCGAGATCTCAACCATTGGCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-326s1c1
Sequence:CCGGCAACCTCTATGGGAAAGACATCTCGAGATGTCTTTCCCATAGAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-449s1c1
Sequence:CCGGGCTTGCCTTGATCAAAGAGAACTCGAGTTCTCTTTGATCAAGGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-444s1c1
Sequence:CCGGGCCAAGCTTGCCTTGATCAAACTCGAGTTTGATCAAGGCAAGCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-516s1c1
Sequence:CCGGCATGGACAAGACTACCTTGTTCTCGAGAACAAGGTAGTCTTGTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-481s1c1
Sequence:CCGGGCTACTTCCCTGCCTTTGAAACTCGAGTTTCAAAGGCAGGGAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-169s1c1
Sequence:CCGGGAGTAGAGTTTGAAGAGAAATCTCGAGATTTCTCTTCAAACTCTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145740.3-919s21c1
Sequence:CCGGACAACTCCTATTCGCTGACTTCTCGAGAAGTCAGCGAATAGGAGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145740.3-803s21c1
Sequence:CCGGGAACTTGCAATACCAATGTTCCTCGAGGAACATTGGTATTGCAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145740.3-1082s21c1
Sequence:CCGGTGTCCCGTAACATACAATTTGCTCGAGCAAATTGTATGTTACGGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145740
GSTA1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase alpha 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-162s1c1
Sequence:CCGGGCAGCTGGAGTAGAGTTTGAACTCGAGTTCAAACTCTACTCCAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-248s1c1
Sequence:CCGGGCAAGTGCCAATGGTTGAGATCTCGAGATCTCAACCATTGGCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-326s1c1
Sequence:CCGGCAACCTCTATGGGAAAGACATCTCGAGATGTCTTTCCCATAGAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-449s1c1
Sequence:CCGGGCTTGCCTTGATCAAAGAGAACTCGAGTTCTCTTTGATCAAGGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163317    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-444s1c1
Sequence:CCGGGCCAAGCTTGCCTTGATCAAACTCGAGTTTGATCAAGGCAAGCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-516s1c1
Sequence:CCGGCATGGACAAGACTACCTTGTTCTCGAGAACAAGGTAGTCTTGTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-481s1c1
Sequence:CCGGGCTACTTCCCTGCCTTTGAAACTCGAGTTTCAAAGGCAGGGAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145740.1-169s1c1
Sequence:CCGGGAGTAGAGTTTGAAGAGAAATCTCGAGATTTCTCTTCAAACTCTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145740.3-919s21c1
Sequence:CCGGACAACTCCTATTCGCTGACTTCTCGAGAAGTCAGCGAATAGGAGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145740.3-803s21c1
Sequence:CCGGGAACTTGCAATACCAATGTTCCTCGAGGAACATTGGTATTGCAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145740.3-1082s21c1
Sequence:CCGGTGTCCCGTAACATACAATTTGCTCGAGCAAATTGTATGTTACGGGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)