EMAIL THIS PAGE TO A FRIEND

GSTA2

glutathione S-transferase alpha 2

25 Gene Product Result for
Synonyms: GST2 GSTA2-2 GTA2 GTH2
UniProtKB ID: P09210, Q12759, Q16491, Q9NTY6
Gene ID:
Human(2939) Summary: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes function in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding these enzymes are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of some drugs. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class. The alpha class genes, located in a cluster mapped to chromosome 6, are the most abundantly expressed glutathione S-transferases in liver. In addition to metabolizing bilirubin and certain anti-cancer drugs in the liver, the alpha class of these enzymes exhibit glutathione peroxidase activity thereby protecting the cells from reactive oxygen species and the products of peroxidation. [provided by RefSeq, Jul 2008]
Mouse(14858) glutathione S-transferase, alpha 2 (Yc2)
Rat(24422) glutathione S-transferase alpha 2
domestic cat(101096317) glutathione S-transferase alpha 2
cow(281805) glutathione S-transferase alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS61 GST A2-2, Recombinant Human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000846 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000846 Rosetta Predictions human pricing
NM_017013 Rosetta Predictions rat pricing
NM_008182 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162445 predicted 621
2 SASI_Hs01_00162446 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017013 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100966 predicted 336
2 SASI_Rn01_00100967 predicted 339
3 SASI_Rn01_00100968 predicted 740
4 SASI_Rn01_00100969 predicted 145
5 SASI_Rn01_00100970 predicted 740
6 SASI_Rn01_00100971 predicted 141
7 SASI_Rn01_00100972 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042053 predicted 559
2 SASI_Mm01_00042054 predicted 806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008182
GSTA2 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase alpha 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-305s1c1
Sequence:CCGGGCCACCAAATATGACCTCTATCTCGAGATAGAGGTCATATTTGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-559s1c1
Sequence:CCGGGCTGGAACTTCTTCTCTATGTCTCGAGACATAGAGAAGAAGTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-385s1c1
Sequence:CCGGGACTGAAATGATTGGGCAATTCTCGAGAATTGCCCAATCATTTCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-161s1c1
Sequence:CCGGGTGGAGTTTGAAGAGAAGTTTCTCGAGAAACTTCTCTTCAAACTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-653s1c1
Sequence:CCGGCCCAATGTGAAGAAGTTCCTACTCGAGTAGGAACTTCTTCACATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008182.3-496s21c1
Sequence:CCGGGTTGAAGAGCCATGGACAAGACTCGAGTCTTGTCCATGGCTCTTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008182.3-282s21c1
Sequence:CCGGCCAGAGCCATTCTCAACTACACTCGAGTGTAGTTGAGAATGGCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008182.3-615s21c1
Sequence:CCGGCTCTGCTGAAGGCCTTCAAGACTCGAGTCTTGAAGGCCTTCAGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008182.3-183s21c1
Sequence:CCGGTACAGAGTCCGGAAGATTTGGCTCGAGCCAAATCTTCCGGACTCTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008182
GSTA2 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase alpha 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-305s1c1
Sequence:CCGGGCCACCAAATATGACCTCTATCTCGAGATAGAGGTCATATTTGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-559s1c1
Sequence:CCGGGCTGGAACTTCTTCTCTATGTCTCGAGACATAGAGAAGAAGTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-385s1c1
Sequence:CCGGGACTGAAATGATTGGGCAATTCTCGAGAATTGCCCAATCATTTCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-161s1c1
Sequence:CCGGGTGGAGTTTGAAGAGAAGTTTCTCGAGAAACTTCTCTTCAAACTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-653s1c1
Sequence:CCGGCCCAATGTGAAGAAGTTCCTACTCGAGTAGGAACTTCTTCACATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008182.3-496s21c1
Sequence:CCGGGTTGAAGAGCCATGGACAAGACTCGAGTCTTGTCCATGGCTCTTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008182.3-282s21c1
Sequence:CCGGCCAGAGCCATTCTCAACTACACTCGAGTGTAGTTGAGAATGGCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008182.3-615s21c1
Sequence:CCGGCTCTGCTGAAGGCCTTCAAGACTCGAGTCTTGAAGGCCTTCAGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008182.3-183s21c1
Sequence:CCGGTACAGAGTCCGGAAGATTTGGCTCGAGCCAAATCTTCCGGACTCTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008182
GSTA2 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase alpha 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-305s1c1
Sequence:CCGGGCCACCAAATATGACCTCTATCTCGAGATAGAGGTCATATTTGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-559s1c1
Sequence:CCGGGCTGGAACTTCTTCTCTATGTCTCGAGACATAGAGAAGAAGTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-385s1c1
Sequence:CCGGGACTGAAATGATTGGGCAATTCTCGAGAATTGCCCAATCATTTCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-161s1c1
Sequence:CCGGGTGGAGTTTGAAGAGAAGTTTCTCGAGAAACTTCTCTTCAAACTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008182.2-653s1c1
Sequence:CCGGCCCAATGTGAAGAAGTTCCTACTCGAGTAGGAACTTCTTCACATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008182.3-496s21c1
Sequence:CCGGGTTGAAGAGCCATGGACAAGACTCGAGTCTTGTCCATGGCTCTTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008182.3-282s21c1
Sequence:CCGGCCAGAGCCATTCTCAACTACACTCGAGTGTAGTTGAGAATGGCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008182.3-615s21c1
Sequence:CCGGCTCTGCTGAAGGCCTTCAAGACTCGAGTCTTGAAGGCCTTCAGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008182.3-183s21c1
Sequence:CCGGTACAGAGTCCGGAAGATTTGGCTCGAGCCAAATCTTCCGGACTCTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000846
GSTA2 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase alpha 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000152045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-732s1c1
Sequence:CCGGCCCATGGATGAGAAATCTTTACTCGAGTAAAGATTTCTCATCCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000846.3-801s1c1
Sequence:CCGGCAAGAACATGCAAGACCAGTACTCGAGTACTGGTCTTGCATGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-327s1c1
Sequence:CCGGCTCAACTACATTGCCAGCAAACTCGAGTTTGCTGGCAATGTAGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-273s1c1
Sequence:CCGGCAAGTGCCAATGGTTGAGATTCTCGAGAATCTCAACCATTGGCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-272s1c1
Sequence:CCGGGCAAGTGCCAATGGTTGAGATCTCGAGATCTCAACCATTGGCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-582s1c1
Sequence:CCGGGACATTCACCTGGTGGAACTTCTCGAGAAGTTCCACCAGGTGAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000846.4-963s21c1
Sequence:CCGGCCTATTCACCCACTTAGTTAACTCGAGTTAACTAAGTGGGTGAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000846
GSTA2 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase alpha 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000152045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-732s1c1
Sequence:CCGGCCCATGGATGAGAAATCTTTACTCGAGTAAAGATTTCTCATCCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000846.3-801s1c1
Sequence:CCGGCAAGAACATGCAAGACCAGTACTCGAGTACTGGTCTTGCATGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-327s1c1
Sequence:CCGGCTCAACTACATTGCCAGCAAACTCGAGTTTGCTGGCAATGTAGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-273s1c1
Sequence:CCGGCAAGTGCCAATGGTTGAGATTCTCGAGAATCTCAACCATTGGCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-272s1c1
Sequence:CCGGGCAAGTGCCAATGGTTGAGATCTCGAGATCTCAACCATTGGCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-582s1c1
Sequence:CCGGGACATTCACCTGGTGGAACTTCTCGAGAAGTTCCACCAGGTGAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000846.4-963s21c1
Sequence:CCGGCCTATTCACCCACTTAGTTAACTCGAGTTAACTAAGTGGGTGAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000846
GSTA2 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase alpha 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000152045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-732s1c1
Sequence:CCGGCCCATGGATGAGAAATCTTTACTCGAGTAAAGATTTCTCATCCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000846.3-801s1c1
Sequence:CCGGCAAGAACATGCAAGACCAGTACTCGAGTACTGGTCTTGCATGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-327s1c1
Sequence:CCGGCTCAACTACATTGCCAGCAAACTCGAGTTTGCTGGCAATGTAGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-273s1c1
Sequence:CCGGCAAGTGCCAATGGTTGAGATTCTCGAGAATCTCAACCATTGGCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-272s1c1
Sequence:CCGGGCAAGTGCCAATGGTTGAGATCTCGAGATCTCAACCATTGGCACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000846.3-582s1c1
Sequence:CCGGGACATTCACCTGGTGGAACTTCTCGAGAAGTTCCACCAGGTGAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000846.4-963s21c1
Sequence:CCGGCCTATTCACCCACTTAGTTAACTCGAGTTAACTAAGTGGGTGAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)