EMAIL THIS PAGE TO A FRIEND

GSTA4

glutathione S-transferase alpha 4

50 Gene Product Result for
Synonyms: GSTA4-4 GTA4
UniProtKB ID: O15217, B2RD15, Q5T7Q8, Q9BX18, Q9H414
Gene ID:
Human(2941) Summary: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. These enzymes are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-tranferase belonging to the alpha class. The alpha class genes, which are located in a cluster on chromosome 6, are highly related and encode enzymes with glutathione peroxidase activity that function in the detoxification of lipid peroxidation products. Reactive electrophiles produced by oxidative metabolism have been linked to a number of degenerative diseases including Parkinson's disease, Alzheimer's disease, cataract formation, and atherosclerosis. [provided by RefSeq, Jul 2008]
Mouse(14860) glutathione S-transferase, alpha 4
Rat(300850) glutathione S-transferase alpha 4
domestic guinea pig(100732190) glutathione S-transferase alpha 4
naked mole-rat(101714626) glutathione S-transferase alpha 4
cow(533917) glutathione S-transferase alpha 4
Horse(100056597) glutathione S-transferase alpha 4
dog(474939) glutathione S-transferase alpha 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS64 GST A4-4, Recombinant Human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001512 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001512 Rosetta Predictions human pricing
NM_001106840 Rosetta Predictions rat pricing
NM_010357 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146157 predicted 309
2 SASI_Hs01_00146158 predicted 366
3 SASI_Hs01_00146161 predicted 758
4 SASI_Hs02_00332019 predicted 472
5 SASI_Hs01_00146162 predicted 839
6 SASI_Hs01_00146163 predicted 341
7 SASI_Hs01_00146164 predicted 786
8 SASI_Hs01_00146165 predicted 622
9 SASI_Hs02_00332020 predicted 672
10 SASI_Hs02_00332021 predicted 537
11 SASI_Hs01_00146156 predicted 661
12 SASI_Hs01_00146159 predicted 428
13 SASI_Hs01_00146160 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222924 predicted 282
2 SASI_Rn02_00222925 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081776 predicted 274
2 SASI_Mm01_00081777 predicted 428
3 SASI_Mm02_00318391 predicted 649
4 SASI_Mm02_00318392 predicted 199
5 SASI_Mm01_00081779 predicted 504
6 SASI_Mm01_00081780 predicted 367
7 SASI_Mm02_00318393 predicted 563
8 SASI_Mm01_00081782 predicted 676
9 SASI_Mm01_00081784 predicted 583
10 SASI_Mm02_00318394 predicted 202
11 SASI_Mm01_00081778 predicted 229
12 SASI_Mm01_00081781 predicted 463
13 SASI_Mm01_00081783 predicted 226
14 SASI_Mm01_00081785 predicted 642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010357
VALIDATED
GSTA4 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase alpha 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010357.3-385s21c1
Sequence:CCGGGAGTCAGGATTGACATGTATGCTCGAGCATACATGTCAATCCTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010357.3-434s21c1
Sequence:CCGGGATTGCCGTGGCTCCATTTAACTCGAGTTAAATGGAGCCACGGCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010357.3-350s21c1
Sequence:CCGGCAAGTACAACTTGTATGGGAACTCGAGTTCCCATACAAGTTGTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010357.3-797s21c1
Sequence:CCGGGCTTTAAGGTGGCACCCACAACTCGAGTTGTGGGTGCCACCTTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010357.3-234s21c1
Sequence:CCGGGAACAGTATGAGAAGATGCAACTCGAGTTGCATCTTCTCATACTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010357.1-297s1c1
Sequence:CCGGGCTGCCAAGTACAACTTGTATCTCGAGATACAAGTTGTACTTGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010357.1-302s1c1
Sequence:CCGGCAAGTACAACTTGTATGGGAACTCGAGTTCCCATACAAGTTGTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010357.1-430s1c1
Sequence:CCGGGCTATGATTTGATACTGTCAACTCGAGTTGACAGTATCAAATCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010357.1-614s1c1
Sequence:CCGGGCAGGCATTTAAGACAAGAATCTCGAGATTCTTGTCTTAAATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010357.1-186s1c1
Sequence:CCGGGAACAGTATGAGAAGATGCAACTCGAGTTGCATCTTCTCATACTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010357
VALIDATED
GSTA4 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase alpha 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010357.3-385s21c1
Sequence:CCGGGAGTCAGGATTGACATGTATGCTCGAGCATACATGTCAATCCTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010357.3-434s21c1
Sequence:CCGGGATTGCCGTGGCTCCATTTAACTCGAGTTAAATGGAGCCACGGCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010357.3-350s21c1
Sequence:CCGGCAAGTACAACTTGTATGGGAACTCGAGTTCCCATACAAGTTGTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010357.3-797s21c1
Sequence:CCGGGCTTTAAGGTGGCACCCACAACTCGAGTTGTGGGTGCCACCTTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010357.3-234s21c1
Sequence:CCGGGAACAGTATGAGAAGATGCAACTCGAGTTGCATCTTCTCATACTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010357.1-297s1c1
Sequence:CCGGGCTGCCAAGTACAACTTGTATCTCGAGATACAAGTTGTACTTGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010357.1-302s1c1
Sequence:CCGGCAAGTACAACTTGTATGGGAACTCGAGTTCCCATACAAGTTGTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010357.1-430s1c1
Sequence:CCGGGCTATGATTTGATACTGTCAACTCGAGTTGACAGTATCAAATCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010357.1-614s1c1
Sequence:CCGGGCAGGCATTTAAGACAAGAATCTCGAGATTCTTGTCTTAAATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010357.1-186s1c1
Sequence:CCGGGAACAGTATGAGAAGATGCAACTCGAGTTGCATCTTCTCATACTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010357
VALIDATED
GSTA4 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase alpha 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010357.3-385s21c1
Sequence:CCGGGAGTCAGGATTGACATGTATGCTCGAGCATACATGTCAATCCTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010357.3-434s21c1
Sequence:CCGGGATTGCCGTGGCTCCATTTAACTCGAGTTAAATGGAGCCACGGCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010357.3-350s21c1
Sequence:CCGGCAAGTACAACTTGTATGGGAACTCGAGTTCCCATACAAGTTGTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010357.3-797s21c1
Sequence:CCGGGCTTTAAGGTGGCACCCACAACTCGAGTTGTGGGTGCCACCTTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010357.3-234s21c1
Sequence:CCGGGAACAGTATGAGAAGATGCAACTCGAGTTGCATCTTCTCATACTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010357.1-297s1c1
Sequence:CCGGGCTGCCAAGTACAACTTGTATCTCGAGATACAAGTTGTACTTGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010357.1-302s1c1
Sequence:CCGGCAAGTACAACTTGTATGGGAACTCGAGTTCCCATACAAGTTGTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010357.1-430s1c1
Sequence:CCGGGCTATGATTTGATACTGTCAACTCGAGTTGACAGTATCAAATCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010357.1-614s1c1
Sequence:CCGGGCAGGCATTTAAGACAAGAATCTCGAGATTCTTGTCTTAAATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010357.1-186s1c1
Sequence:CCGGGAACAGTATGAGAAGATGCAACTCGAGTTGCATCTTCTCATACTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001512
VALIDATED
GSTA4 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase alpha 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001512.3-798s21c1
Sequence:CCGGCTACAACATCTTTAGGCCATACTCGAGTATGGCCTAAAGATGTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001512.3-384s21c1
Sequence:CCGGGCACAATCTCTTTGGCAAGAACTCGAGTTCTTGCCAAAGAGATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001512.3-896s21c1
Sequence:CCGGGCTCTGTCATGGTGCTATCTACTCGAGTAGATAGCACCATGACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001512.3-1157s21c1
Sequence:CCGGGCGTCTTTCTGCTCTCCTTATCTCGAGATAAGGAGAGCAGAAAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001512.3-366s21c1
Sequence:CCGGCCACTACATAGCAGACAAGCACTCGAGTGCTTGTCTGCTATGTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001512.2-328s1c1
Sequence:CCGGCCACTACATAGCAGACAAGCACTCGAGTGCTTGTCTGCTATGTAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001512.2-1119s1c1
Sequence:CCGGGCGTCTTTCTGCTCTCCTTATCTCGAGATAAGGAGAGCAGAAAGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001512.2-858s1c1
Sequence:CCGGGCTCTGTCATGGTGCTATCTACTCGAGTAGATAGCACCATGACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001512.2-653s1c1
Sequence:CCGGCTCCAGGAATACACAGTGAAACTCGAGTTTCACTGTGTATTCCTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001512.2-751s1c1
Sequence:CCGGGAGAACCGTCTACAACATCTTCTCGAGAAGATGTTGTAGACGGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001512.2-346s1c1
Sequence:CCGGGCACAATCTCTTTGGCAAGAACTCGAGTTCTTGCCAAAGAGATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001512.2-760s1c1
Sequence:CCGGCTACAACATCTTTAGGCCATACTCGAGTATGGCCTAAAGATGTTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001512
VALIDATED
GSTA4 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase alpha 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001512.3-798s21c1
Sequence:CCGGCTACAACATCTTTAGGCCATACTCGAGTATGGCCTAAAGATGTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001512.3-384s21c1
Sequence:CCGGGCACAATCTCTTTGGCAAGAACTCGAGTTCTTGCCAAAGAGATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001512.3-896s21c1
Sequence:CCGGGCTCTGTCATGGTGCTATCTACTCGAGTAGATAGCACCATGACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001512.3-1157s21c1
Sequence:CCGGGCGTCTTTCTGCTCTCCTTATCTCGAGATAAGGAGAGCAGAAAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001512.3-366s21c1
Sequence:CCGGCCACTACATAGCAGACAAGCACTCGAGTGCTTGTCTGCTATGTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001512.2-328s1c1
Sequence:CCGGCCACTACATAGCAGACAAGCACTCGAGTGCTTGTCTGCTATGTAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001512.2-1119s1c1
Sequence:CCGGGCGTCTTTCTGCTCTCCTTATCTCGAGATAAGGAGAGCAGAAAGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001512.2-858s1c1
Sequence:CCGGGCTCTGTCATGGTGCTATCTACTCGAGTAGATAGCACCATGACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001512.2-653s1c1
Sequence:CCGGCTCCAGGAATACACAGTGAAACTCGAGTTTCACTGTGTATTCCTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001512.2-751s1c1
Sequence:CCGGGAGAACCGTCTACAACATCTTCTCGAGAAGATGTTGTAGACGGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001512.2-346s1c1
Sequence:CCGGGCACAATCTCTTTGGCAAGAACTCGAGTTCTTGCCAAAGAGATTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001512.2-760s1c1
Sequence:CCGGCTACAACATCTTTAGGCCATACTCGAGTATGGCCTAAAGATGTTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001512
VALIDATED
GSTA4 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase alpha 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001512.3-798s21c1
Sequence:CCGGCTACAACATCTTTAGGCCATACTCGAGTATGGCCTAAAGATGTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001512.3-384s21c1
Sequence:CCGGGCACAATCTCTTTGGCAAGAACTCGAGTTCTTGCCAAAGAGATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278246    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001512.3-896s21c1
Sequence:CCGGGCTCTGTCATGGTGCTATCTACTCGAGTAGATAGCACCATGACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001512.3-1157s21c1
Sequence:CCGGGCGTCTTTCTGCTCTCCTTATCTCGAGATAAGGAGAGCAGAAAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001512.3-366s21c1
Sequence:CCGGCCACTACATAGCAGACAAGCACTCGAGTGCTTGTCTGCTATGTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001512.2-328s1c1
Sequence:CCGGCCACTACATAGCAGACAAGCACTCGAGTGCTTGTCTGCTATGTAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001512.2-1119s1c1
Sequence:CCGGGCGTCTTTCTGCTCTCCTTATCTCGAGATAAGGAGAGCAGAAAGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156612    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001512.2-858s1c1
Sequence:CCGGGCTCTGTCATGGTGCTATCTACTCGAGTAGATAGCACCATGACAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001512.2-653s1c1
Sequence:CCGGCTCCAGGAATACACAGTGAAACTCGAGTTTCACTGTGTATTCCTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001512.2-751s1c1
Sequence:CCGGGAGAACCGTCTACAACATCTTCTCGAGAAGATGTTGTAGACGGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001512.2-346s1c1
Sequence:CCGGGCACAATCTCTTTGGCAAGAACTCGAGTTCTTGCCAAAGAGATTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001512.2-760s1c1
Sequence:CCGGCTACAACATCTTTAGGCCATACTCGAGTATGGCCTAAAGATGTTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)