EMAIL THIS PAGE TO A FRIEND

GSTK1

glutathione S-transferase kappa 1

52 Gene Product Result for
Synonyms: GST GST 13-13 GST13 GST13-13 GSTK1-1 hGSTK1
UniProtKB ID: Q9Y2Q3, B4DIH1, B4DSY2, Q6P4H0, Q7Z520, Q9P1S4
Gene ID:
Human(373156) Summary: This gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. The encoded protein is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
Mouse(76263) glutathione S-transferase kappa 1
Rat(297029) glutathione S-transferase kappa 1
chicken(418302) glutathione S-transferase kappa 1
cow(613498) glutathione S-transferase kappa 1
domestic cat(101087726) glutathione S-transferase kappa 1
dog(475518) glutathione S-transferase kappa 1
sheep(101114517) glutathione S-transferase kappa 1
domestic guinea pig(100714509) glutathione S-transferase kappa 1
naked mole-rat(101713648) glutathione S-transferase kappa 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS71 GST K1-1, Recombinant Human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029555 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029555 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029555 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015917 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056581 MISSION® esiRNA esiRNA human GSTK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015917 Rosetta Predictions human pricing
NM_181371 Rosetta Predictions rat pricing
NM_029555 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042872 predicted 726
2 SASI_Hs02_00348532 predicted 226
3 SASI_Hs01_00042874 predicted 690
4 SASI_Hs01_00042875 predicted 324
5 SASI_Hs01_00042876 predicted 376
6 SASI_Hs01_00042877 predicted 705
7 SASI_Hs01_00042878 predicted 608
8 SASI_Hs01_00042879 predicted 399
9 SASI_Hs01_00042880 predicted 419
10 SASI_Hs01_00042881 predicted 643
11 SASI_Hs01_00042873 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037598 predicted 313
2 SASI_Rn01_00037599 predicted 218
3 SASI_Rn01_00037600 predicted 634
4 SASI_Rn01_00037601 predicted 491
5 SASI_Rn01_00037603 predicted 403
6 SASI_Rn01_00037604 predicted 300
7 SASI_Rn01_00037605 predicted 466
8 SASI_Rn01_00037606 predicted 621
9 SASI_Rn01_00037607 predicted 409
10 SASI_Rn02_00269702 predicted 582
11 SASI_Rn01_00037602 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100424 predicted 696
2 SASI_Mm01_00100425 predicted 624
3 SASI_Mm01_00100426 predicted 641
4 SASI_Mm01_00100427 predicted 322
5 SASI_Mm01_00100428 predicted 439
6 SASI_Mm01_00100429 predicted 208
7 SASI_Mm01_00100430 predicted 350
8 SASI_Mm01_00100431 predicted 332
9 SASI_Mm01_00100432 predicted 484
10 SASI_Mm01_00100433 predicted 472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029555
VALIDATED
GSTK1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase kappa 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029555.1-772s1c1
Sequence:CCGGCCTTACAGAGTAATCTTTGATCTCGAGATCAAAGATTACTCTGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029555.1-324s1c1
Sequence:CCGGCCCTCAACATACCCAAGGATTCTCGAGAATCCTTGGGTATGTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029555.1-354s1c1
Sequence:CCGGAGACTGTGAAGAAAGGAAGTACTCGAGTACTTCCTTTCTTCACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029555.1-744s1c1
Sequence:CCGGCAACTGCGAATGCCAGACTTTCTCGAGAAAGTCTGGCATTCGCAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029555.1-205s1c1
Sequence:CCGGGCCCACTTTAATCGCTGGGATCTCGAGATCCCAGCGATTAAAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029555.2-774s21c1
Sequence:CCGGCCTTACAGAGTAATCTTTGATCTCGAGATCAAAGATTACTCTGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029555.2-473s21c1
Sequence:CCGGATGAAGATATCACGGAGTATCCTCGAGGATACTCCGTGATATCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029555.2-746s21c1
Sequence:CCGGCAACTGCGAATGCCAGACTTTCTCGAGAAAGTCTGGCATTCGCAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029555.2-360s21c1
Sequence:CCGGTGTGAAGAAAGGAAGTATAAACTCGAGTTTATACTTCCTTTCTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029555.2-172s21c1
Sequence:CCGGTACCAACACCTCTGGAATATACTCGAGTATATTCCAGAGGTGTTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029555
VALIDATED
GSTK1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase kappa 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029555.1-772s1c1
Sequence:CCGGCCTTACAGAGTAATCTTTGATCTCGAGATCAAAGATTACTCTGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029555.1-324s1c1
Sequence:CCGGCCCTCAACATACCCAAGGATTCTCGAGAATCCTTGGGTATGTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029555.1-354s1c1
Sequence:CCGGAGACTGTGAAGAAAGGAAGTACTCGAGTACTTCCTTTCTTCACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029555.1-744s1c1
Sequence:CCGGCAACTGCGAATGCCAGACTTTCTCGAGAAAGTCTGGCATTCGCAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029555.1-205s1c1
Sequence:CCGGGCCCACTTTAATCGCTGGGATCTCGAGATCCCAGCGATTAAAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029555.2-774s21c1
Sequence:CCGGCCTTACAGAGTAATCTTTGATCTCGAGATCAAAGATTACTCTGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029555.2-473s21c1
Sequence:CCGGATGAAGATATCACGGAGTATCCTCGAGGATACTCCGTGATATCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029555.2-746s21c1
Sequence:CCGGCAACTGCGAATGCCAGACTTTCTCGAGAAAGTCTGGCATTCGCAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029555.2-360s21c1
Sequence:CCGGTGTGAAGAAAGGAAGTATAAACTCGAGTTTATACTTCCTTTCTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029555.2-172s21c1
Sequence:CCGGTACCAACACCTCTGGAATATACTCGAGTATATTCCAGAGGTGTTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029555
VALIDATED
GSTK1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase kappa 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029555.1-772s1c1
Sequence:CCGGCCTTACAGAGTAATCTTTGATCTCGAGATCAAAGATTACTCTGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029555.1-324s1c1
Sequence:CCGGCCCTCAACATACCCAAGGATTCTCGAGAATCCTTGGGTATGTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029555.1-354s1c1
Sequence:CCGGAGACTGTGAAGAAAGGAAGTACTCGAGTACTTCCTTTCTTCACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029555.1-744s1c1
Sequence:CCGGCAACTGCGAATGCCAGACTTTCTCGAGAAAGTCTGGCATTCGCAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029555.1-205s1c1
Sequence:CCGGGCCCACTTTAATCGCTGGGATCTCGAGATCCCAGCGATTAAAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029555.2-774s21c1
Sequence:CCGGCCTTACAGAGTAATCTTTGATCTCGAGATCAAAGATTACTCTGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029555.2-473s21c1
Sequence:CCGGATGAAGATATCACGGAGTATCCTCGAGGATACTCCGTGATATCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029555.2-746s21c1
Sequence:CCGGCAACTGCGAATGCCAGACTTTCTCGAGAAAGTCTGGCATTCGCAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029555.2-360s21c1
Sequence:CCGGTGTGAAGAAAGGAAGTATAAACTCGAGTTTATACTTCCTTTCTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029555.2-172s21c1
Sequence:CCGGTACCAACACCTCTGGAATATACTCGAGTATATTCCAGAGGTGTTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015917
VALIDATED
GSTK1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase kappa 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-476s1c1
Sequence:CCGGGCTGGTATGTCTGCAGAACAACTCGAGTTGTTCTGCAGACATACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-124s1c1
Sequence:CCGGCCGGTATCAGAATATCTGGAACTCGAGTTCCAGATATTCTGATACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-816s1c1
Sequence:CCGGCTCTATCTGATAGAGGTATTTCTCGAGAAATACCTCTATCAGATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-418s1c1
Sequence:CCGGCTGGTCAAGGAATGAAGACATCTCGAGATGTCTTCATTCCTTGACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015917.1-225s1c1
Sequence:CCGGGCAAAGGACTATACATGGCAACTCGAGTTGCCATGTATAGTCCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-734s1c1
Sequence:CCGGGAGGAAGCAAACTCTTCGTATCTCGAGATACGAAGAGTTTGCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-807s1c1
Sequence:CCGGCTCGGATTTCTCTATCTGATACTCGAGTATCAGATAGAGAAATCCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-737s1c1
Sequence:CCGGGAAGCAAACTCTTCGTATAAACTCGAGTTTATACGAAGAGTTTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-127s1c1
Sequence:CCGGGTATCAGAATATCTGGAACATCTCGAGATGTTCCAGATATTCTGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-299s1c1
Sequence:CCGGGATTTCTTGTCTGTGATGCTTCTCGAGAAGCATCACAGACAAGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015917.2-776s21c1
Sequence:CCGGGAGGAAGCAAACTCTTCGTATCTCGAGATACGAAGAGTTTGCTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015917.2-858s21c1
Sequence:CCGGCTCTATCTGATAGAGGTATTTCTCGAGAAATACCTCTATCAGATAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015917.2-518s21c1
Sequence:CCGGGCTGGTATGTCTGCAGAACAACTCGAGTTGTTCTGCAGACATACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015917.2-849s21c1
Sequence:CCGGCTCGGATTTCTCTATCTGATACTCGAGTATCAGATAGAGAAATCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015917
VALIDATED
GSTK1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase kappa 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-476s1c1
Sequence:CCGGGCTGGTATGTCTGCAGAACAACTCGAGTTGTTCTGCAGACATACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-124s1c1
Sequence:CCGGCCGGTATCAGAATATCTGGAACTCGAGTTCCAGATATTCTGATACCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-816s1c1
Sequence:CCGGCTCTATCTGATAGAGGTATTTCTCGAGAAATACCTCTATCAGATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-418s1c1
Sequence:CCGGCTGGTCAAGGAATGAAGACATCTCGAGATGTCTTCATTCCTTGACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015917.1-225s1c1
Sequence:CCGGGCAAAGGACTATACATGGCAACTCGAGTTGCCATGTATAGTCCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-734s1c1
Sequence:CCGGGAGGAAGCAAACTCTTCGTATCTCGAGATACGAAGAGTTTGCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-807s1c1
Sequence:CCGGCTCGGATTTCTCTATCTGATACTCGAGTATCAGATAGAGAAATCCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-737s1c1
Sequence:CCGGGAAGCAAACTCTTCGTATAAACTCGAGTTTATACGAAGAGTTTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-127s1c1
Sequence:CCGGGTATCAGAATATCTGGAACATCTCGAGATGTTCCAGATATTCTGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-299s1c1
Sequence:CCGGGATTTCTTGTCTGTGATGCTTCTCGAGAAGCATCACAGACAAGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015917.2-776s21c1
Sequence:CCGGGAGGAAGCAAACTCTTCGTATCTCGAGATACGAAGAGTTTGCTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015917.2-858s21c1
Sequence:CCGGCTCTATCTGATAGAGGTATTTCTCGAGAAATACCTCTATCAGATAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015917.2-518s21c1
Sequence:CCGGGCTGGTATGTCTGCAGAACAACTCGAGTTGTTCTGCAGACATACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015917.2-849s21c1
Sequence:CCGGCTCGGATTTCTCTATCTGATACTCGAGTATCAGATAGAGAAATCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015917
VALIDATED
GSTK1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase kappa 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-476s1c1
Sequence:CCGGGCTGGTATGTCTGCAGAACAACTCGAGTTGTTCTGCAGACATACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-124s1c1
Sequence:CCGGCCGGTATCAGAATATCTGGAACTCGAGTTCCAGATATTCTGATACCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-816s1c1
Sequence:CCGGCTCTATCTGATAGAGGTATTTCTCGAGAAATACCTCTATCAGATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-418s1c1
Sequence:CCGGCTGGTCAAGGAATGAAGACATCTCGAGATGTCTTCATTCCTTGACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015917.1-225s1c1
Sequence:CCGGGCAAAGGACTATACATGGCAACTCGAGTTGCCATGTATAGTCCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-734s1c1
Sequence:CCGGGAGGAAGCAAACTCTTCGTATCTCGAGATACGAAGAGTTTGCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-807s1c1
Sequence:CCGGCTCGGATTTCTCTATCTGATACTCGAGTATCAGATAGAGAAATCCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-737s1c1
Sequence:CCGGGAAGCAAACTCTTCGTATAAACTCGAGTTTATACGAAGAGTTTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-127s1c1
Sequence:CCGGGTATCAGAATATCTGGAACATCTCGAGATGTTCCAGATATTCTGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015917.1-299s1c1
Sequence:CCGGGATTTCTTGTCTGTGATGCTTCTCGAGAAGCATCACAGACAAGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015917.2-776s21c1
Sequence:CCGGGAGGAAGCAAACTCTTCGTATCTCGAGATACGAAGAGTTTGCTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015917.2-858s21c1
Sequence:CCGGCTCTATCTGATAGAGGTATTTCTCGAGAAATACCTCTATCAGATAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015917.2-518s21c1
Sequence:CCGGGCTGGTATGTCTGCAGAACAACTCGAGTTGTTCTGCAGACATACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015917.2-849s21c1
Sequence:CCGGCTCGGATTTCTCTATCTGATACTCGAGTATCAGATAGAGAAATCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)