EMAIL THIS PAGE TO A FRIEND

GSTM2

glutathione S-transferase mu 2 (muscle)

57 Gene Product Result for
Synonyms: GST4 GSTM GSTM2-2 GTHMUS
UniProtKB ID: P28161, B4DRY4, E9PEM9, Q2M318, Q5TZY5, Q8WWE1
Gene ID:
Human(2946) Summary: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. [provided by RefSeq, Jul 2008]
Mouse(14863) glutathione S-transferase, mu 2
Rat(24424) glutathione S-transferase mu 2
sheep(100294593) glutathione S-transferase mu 2 (muscle)
Domestic Rabbit(100009073) glutathione S-transferase mu 2 (muscle)
domestic guinea pig(100379537) glutathione S-transferase, mu 2
domestic guinea pig(100732167) glutathione S-transferase mu 2 (muscle)
chicken(395976) glutathione S-transferase mu 2 (muscle)
cow(615537) glutathione S-transferase M2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108560 Anti-GSTM2 affinity isolated antibody human
immunohistochemistry, western blot pricing
AV41818 Anti-GSTM2 antibody produced in rabbit affinity isolated antibody human, zebrafish
immunohistochemistry, western blot pricing
SAB4300720 Anti-GSTM2 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB1402216 Monoclonal Anti-GSTM2 antibody produced in mouse clone 1E10, purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

Cell Lines

Product # Description Species Add to Cart
 
GS66 GST M2-2, Recombinant Human human pricing

Proteins

Product # Description Species Add to Cart
 
SRP6100 GSTM2 human recombinant, expressed in E. coli, ≥95% (SDS-PAGE) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008183 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008183 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008183 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000848 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU071421 MISSION® esiRNA esiRNA targeting mouse Gstm2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000848 Rosetta Predictions human pricing
NM_177426 Rosetta Predictions rat pricing
NM_008183 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178377 predicted 364
2 SASI_Hs01_00178378 predicted 318
3 SASI_Hs01_00178379 predicted 349
4 SASI_Hs01_00178380 predicted 375
5 SASI_Hs01_00178381 predicted 508
6 SASI_Hs01_00178382 predicted 366
7 SASI_Hs01_00178383 predicted 315
8 SASI_Hs01_00178384 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082546 predicted 346
2 SASI_Rn01_00082549 predicted 348
3 SASI_Rn01_00082550 predicted 315
4 SASI_Rn01_00082551 predicted 319
5 SASI_Rn01_00082552 predicted 301
6 SASI_Rn01_00082553 predicted 352
7 SASI_Rn01_00082554 predicted 307
8 SASI_Rn01_00082555 predicted 312
9 SASI_Rn02_00269584 predicted 355
10 SASI_Rn02_00269585 predicted 538
11 SASI_Rn01_00082547 predicted 390
12 SASI_Rn01_00082548 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008183 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162648 predicted 580
2 SASI_Mm01_00162649 predicted 361
3 SASI_Mm01_00162650 predicted 525
4 SASI_Mm01_00162651 predicted 343
5 SASI_Mm01_00162652 predicted 747
6 SASI_Mm01_00162653 predicted 746
7 SASI_Mm02_00313313 predicted 219
8 SASI_Mm02_00313314 predicted 111
9 SASI_Mm02_00313315 predicted 788
10 SASI_Mm02_00313316 predicted 526
11 SASI_Mm01_00162647 predicted 349
12 SASI_Mm01_00162654 predicted 381
13 SASI_Mm01_00162655 predicted 471
14 SASI_Mm01_00162656 predicted 237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008183
VALIDATED
GSTM2 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase mu 2 (muscle)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008183.3-383s21c1
Sequence:CCGGGTTTGCTACAGCCCTGACTTTCTCGAGAAAGTCAGGGCTGTAGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008183.3-655s21c1
Sequence:CCGGCTCCAAGCCAATCTTTGCAAACTCGAGTTTGCAAAGATTGGCTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008183.3-532s21c1
Sequence:CCGGCCTTGATCAACACCGAATATTCTCGAGAATATTCGGTGTTGATCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008183.3-763s21c1
Sequence:CCGGCGTGCAGCTTTCTTCTCCTTTCTCGAGAAAGGAGAAGAAAGCTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-787s1c1
Sequence:CCGGCGTGCAGCTTTCTTCTCCTTTCTCGAGAAAGGAGAAGAAAGCTGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-679s1c1
Sequence:CCGGCTCCAAGCCAATCTTTGCAAACTCGAGTTTGCAAAGATTGGCTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-407s1c1
Sequence:CCGGGTTTGCTACAGCCCTGACTTTCTCGAGAAAGTCAGGGCTGTAGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-556s1c1
Sequence:CCGGCCTTGATCAACACCGAATATTCTCGAGAATATTCGGTGTTGATCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-554s1c1
Sequence:CCGGGTCCTTGATCAACACCGAATACTCGAGTATTCGGTGTTGATCAAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008183
VALIDATED
GSTM2 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase mu 2 (muscle)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008183.3-383s21c1
Sequence:CCGGGTTTGCTACAGCCCTGACTTTCTCGAGAAAGTCAGGGCTGTAGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008183.3-655s21c1
Sequence:CCGGCTCCAAGCCAATCTTTGCAAACTCGAGTTTGCAAAGATTGGCTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008183.3-532s21c1
Sequence:CCGGCCTTGATCAACACCGAATATTCTCGAGAATATTCGGTGTTGATCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008183.3-763s21c1
Sequence:CCGGCGTGCAGCTTTCTTCTCCTTTCTCGAGAAAGGAGAAGAAAGCTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-787s1c1
Sequence:CCGGCGTGCAGCTTTCTTCTCCTTTCTCGAGAAAGGAGAAGAAAGCTGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-679s1c1
Sequence:CCGGCTCCAAGCCAATCTTTGCAAACTCGAGTTTGCAAAGATTGGCTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-407s1c1
Sequence:CCGGGTTTGCTACAGCCCTGACTTTCTCGAGAAAGTCAGGGCTGTAGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-556s1c1
Sequence:CCGGCCTTGATCAACACCGAATATTCTCGAGAATATTCGGTGTTGATCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-554s1c1
Sequence:CCGGGTCCTTGATCAACACCGAATACTCGAGTATTCGGTGTTGATCAAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008183
VALIDATED
GSTM2 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase mu 2 (muscle)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008183.3-383s21c1
Sequence:CCGGGTTTGCTACAGCCCTGACTTTCTCGAGAAAGTCAGGGCTGTAGCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008183.3-655s21c1
Sequence:CCGGCTCCAAGCCAATCTTTGCAAACTCGAGTTTGCAAAGATTGGCTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008183.3-532s21c1
Sequence:CCGGCCTTGATCAACACCGAATATTCTCGAGAATATTCGGTGTTGATCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008183.3-763s21c1
Sequence:CCGGCGTGCAGCTTTCTTCTCCTTTCTCGAGAAAGGAGAAGAAAGCTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103160    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-787s1c1
Sequence:CCGGCGTGCAGCTTTCTTCTCCTTTCTCGAGAAAGGAGAAGAAAGCTGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-679s1c1
Sequence:CCGGCTCCAAGCCAATCTTTGCAAACTCGAGTTTGCAAAGATTGGCTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-407s1c1
Sequence:CCGGGTTTGCTACAGCCCTGACTTTCTCGAGAAAGTCAGGGCTGTAGCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-556s1c1
Sequence:CCGGCCTTGATCAACACCGAATATTCTCGAGAATATTCGGTGTTGATCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008183.2-554s1c1
Sequence:CCGGGTCCTTGATCAACACCGAATACTCGAGTATTCGGTGTTGATCAAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000848
GSTM2 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase mu 2 (muscle)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-324s1c1
Sequence:CCGGGAGCAGATTCGCGAAGACATTCTCGAGAATGTCTTCGCGAATCTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-508s1c1
Sequence:CCGGCCTTTGTGGATTTCATCGCTTCTCGAGAAGCGATGAAATCCACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000848.2-801s1c1
Sequence:CCGGCCTCGTTCCTTTCTCCTGTTTCTCGAGAAACAGGAGAAAGGAACGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-590s1c1
Sequence:CCGGGAAGGACTTCATCTCCCGATTCTCGAGAATCGGGAGATGAAGTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-353s1c1
Sequence:CCGGCCAGTTTATGGACAGCCGTATCTCGAGATACGGCTGTCCATAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-449s1c1
Sequence:CCGGGCTGAAGCTCTACTCACAGTTCTCGAGAACTGTGAGTAGAGCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000848.2-804s1c1
Sequence:CCGGCGTTCCTTTCTCCTGTTTATTCTCGAGAATAAACAGGAGAAAGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-659s1c1
Sequence:CCGGCCCAAGACCTGTGTTCACAAACTCGAGTTTGTGAACACAGGTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-228s1c1
Sequence:CCGGCCCTACTTGATTGATGGGACTCTCGAGAGTCCCATCAATCAAGTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000848
GSTM2 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase mu 2 (muscle)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-324s1c1
Sequence:CCGGGAGCAGATTCGCGAAGACATTCTCGAGAATGTCTTCGCGAATCTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-508s1c1
Sequence:CCGGCCTTTGTGGATTTCATCGCTTCTCGAGAAGCGATGAAATCCACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000848.2-801s1c1
Sequence:CCGGCCTCGTTCCTTTCTCCTGTTTCTCGAGAAACAGGAGAAAGGAACGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-590s1c1
Sequence:CCGGGAAGGACTTCATCTCCCGATTCTCGAGAATCGGGAGATGAAGTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-353s1c1
Sequence:CCGGCCAGTTTATGGACAGCCGTATCTCGAGATACGGCTGTCCATAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-449s1c1
Sequence:CCGGGCTGAAGCTCTACTCACAGTTCTCGAGAACTGTGAGTAGAGCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000848.2-804s1c1
Sequence:CCGGCGTTCCTTTCTCCTGTTTATTCTCGAGAATAAACAGGAGAAAGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-659s1c1
Sequence:CCGGCCCAAGACCTGTGTTCACAAACTCGAGTTTGTGAACACAGGTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-228s1c1
Sequence:CCGGCCCTACTTGATTGATGGGACTCTCGAGAGTCCCATCAATCAAGTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000848
GSTM2 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase mu 2 (muscle)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-324s1c1
Sequence:CCGGGAGCAGATTCGCGAAGACATTCTCGAGAATGTCTTCGCGAATCTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-508s1c1
Sequence:CCGGCCTTTGTGGATTTCATCGCTTCTCGAGAAGCGATGAAATCCACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000848.2-801s1c1
Sequence:CCGGCCTCGTTCCTTTCTCCTGTTTCTCGAGAAACAGGAGAAAGGAACGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-590s1c1
Sequence:CCGGGAAGGACTTCATCTCCCGATTCTCGAGAATCGGGAGATGAAGTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-353s1c1
Sequence:CCGGCCAGTTTATGGACAGCCGTATCTCGAGATACGGCTGTCCATAAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-449s1c1
Sequence:CCGGGCTGAAGCTCTACTCACAGTTCTCGAGAACTGTGAGTAGAGCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000848.2-804s1c1
Sequence:CCGGCGTTCCTTTCTCCTGTTTATTCTCGAGAATAAACAGGAGAAAGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-659s1c1
Sequence:CCGGCCCAAGACCTGTGTTCACAAACTCGAGTTTGTGAACACAGGTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000848.2-228s1c1
Sequence:CCGGCCCTACTTGATTGATGGGACTCTCGAGAGTCCCATCAATCAAGTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)