EMAIL THIS PAGE TO A FRIEND

GSTM3

glutathione S-transferase mu 3 (brain)

60 Gene Product Result for
Synonyms: GST5 GSTB GSTM3-3 GTM3
UniProtKB ID: P21266, O60550, Q96HA3
Gene ID:
Human(2947) Summary: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Mutations of this class mu gene have been linked with a slight increase in a number of cancers, likely due to exposure with environmental toxins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
Mouse(14864) glutathione S-transferase, mu 3
Rat(57298) glutathione S-transferase mu 3
Zebrafish(568744) glutathione S-transferase M3 (brain)
dog(479911) glutathione S-transferase mu 3 (brain)
cow(615507) glutathione S-transferase mu 3 (brain)
domestic cat(100169963) glutathione S-transferase mu 3 (brain)
naked mole-rat(101708562) glutathione S-transferase mu 3 (brain)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS73 GST M3-3, Recombinant Human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010359 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010359 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010359 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000849 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000849 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000849 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000849 Rosetta Predictions human pricing
NM_020540 Rosetta Predictions rat pricing
NM_010359 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205974 predicted 887
2 SASI_Hs01_00205978 predicted 469
3 SASI_Hs01_00205979 predicted 415
4 SASI_Hs01_00205980 predicted 1075
5 SASI_Hs01_00205981 predicted 992
6 SASI_Hs02_00303356 predicted 213
7 SASI_Hs01_00205982 predicted 453
8 SASI_Hs01_00205983 predicted 214
9 SASI_Hs02_00303357 predicted 723
10 SASI_Hs02_00303358 predicted 440
11 SASI_Hs01_00205975 predicted 627
12 SASI_Hs01_00205976 predicted 260
13 SASI_Hs01_00205977 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120057 predicted 315
2 SASI_Rn01_00120058 predicted 346
3 SASI_Rn01_00120059 predicted 325
4 SASI_Rn01_00120060 predicted 344
5 SASI_Rn01_00120061 predicted 314
6 SASI_Rn01_00120062 predicted 379
7 SASI_Rn01_00120063 predicted 319
8 SASI_Rn02_00262557 predicted 285
9 SASI_Rn02_00262558 predicted 310
10 SASI_Rn02_00262559 predicted 609
11 SASI_Rn01_00120055 predicted 280
12 SASI_Rn01_00120056 predicted 315
13 SASI_Rn01_00120064 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010359 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181227 predicted 630
2 SASI_Mm01_00181228 predicted 338
3 SASI_Mm01_00181229 predicted 626
4 SASI_Mm01_00181230 predicted 337
5 SASI_Mm01_00181231 predicted 621
6 SASI_Mm01_00181232 predicted 293
7 SASI_Mm01_00181233 predicted 339
8 SASI_Mm01_00181234 predicted 295
9 SASI_Mm01_00181235 predicted 628
10 SASI_Mm01_00181236 predicted 308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010359
GSTM3 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase mu 3 (brain)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010359.1-843s21c1
Sequence:CCGGTCAAGCCCATGCAGCCTTTATCTCGAGATAAAGGCTGCATGGGCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010359.1-357s21c1
Sequence:CCGGAGTCTGCTGCAGTCCCGATTTCTCGAGAAATCGGGACTGCAGCAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010359.1-516s21c1
Sequence:CCGGGTATCGTATGTTTGAGCCCAACTCGAGTTGGGCTCAAACATACGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010359.1-976s1c1
Sequence:CCGGCCAATGGTCAACACTATCTTACTCGAGTAAGATAGTGTTGACCATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010359.1-102s1c1
Sequence:CCGGTGAGGAGAAGAGATATGTCATCTCGAGATGACATATCTCTTCTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010359.1-634s1c1
Sequence:CCGGAGACCTGTGTTTACTAAGATACTCGAGTATCTTAGTAAACACAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010359.1-310s1c1
Sequence:CCGGGATACTTTGGAGAACCAAGTTCTCGAGAACTTGGTTCTCCAAAGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010359.1-337s1c1
Sequence:CCGGACCCGCATACAGCTCATGATACTCGAGTATCATGAGCTGTATGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010359
GSTM3 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase mu 3 (brain)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010359.1-843s21c1
Sequence:CCGGTCAAGCCCATGCAGCCTTTATCTCGAGATAAAGGCTGCATGGGCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010359.1-357s21c1
Sequence:CCGGAGTCTGCTGCAGTCCCGATTTCTCGAGAAATCGGGACTGCAGCAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010359.1-516s21c1
Sequence:CCGGGTATCGTATGTTTGAGCCCAACTCGAGTTGGGCTCAAACATACGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010359.1-976s1c1
Sequence:CCGGCCAATGGTCAACACTATCTTACTCGAGTAAGATAGTGTTGACCATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010359.1-102s1c1
Sequence:CCGGTGAGGAGAAGAGATATGTCATCTCGAGATGACATATCTCTTCTCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010359.1-634s1c1
Sequence:CCGGAGACCTGTGTTTACTAAGATACTCGAGTATCTTAGTAAACACAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010359.1-310s1c1
Sequence:CCGGGATACTTTGGAGAACCAAGTTCTCGAGAACTTGGTTCTCCAAAGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010359.1-337s1c1
Sequence:CCGGACCCGCATACAGCTCATGATACTCGAGTATCATGAGCTGTATGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010359
GSTM3 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase mu 3 (brain)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437129    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010359.1-843s21c1
Sequence:CCGGTCAAGCCCATGCAGCCTTTATCTCGAGATAAAGGCTGCATGGGCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010359.1-357s21c1
Sequence:CCGGAGTCTGCTGCAGTCCCGATTTCTCGAGAAATCGGGACTGCAGCAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010359.1-516s21c1
Sequence:CCGGGTATCGTATGTTTGAGCCCAACTCGAGTTGGGCTCAAACATACGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010359.1-976s1c1
Sequence:CCGGCCAATGGTCAACACTATCTTACTCGAGTAAGATAGTGTTGACCATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010359.1-102s1c1
Sequence:CCGGTGAGGAGAAGAGATATGTCATCTCGAGATGACATATCTCTTCTCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010359.1-634s1c1
Sequence:CCGGAGACCTGTGTTTACTAAGATACTCGAGTATCTTAGTAAACACAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010359.1-310s1c1
Sequence:CCGGGATACTTTGGAGAACCAAGTTCTCGAGAACTTGGTTCTCCAAAGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010359.1-337s1c1
Sequence:CCGGACCCGCATACAGCTCATGATACTCGAGTATCATGAGCTGTATGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000849
VALIDATED
GSTM3 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase mu 3 (brain)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000849.4-479s21c1
Sequence:CCGGCTAGACCTGGACTTTCCTAATCTCGAGATTAGGAAAGTCCAGGTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000849.4-614s21c1
Sequence:CCGGGACATCATAGAGAACCAAGTACTCGAGTACTTGGTTCTCTATGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000849.4-1450s21c1
Sequence:CCGGGGGACAATTGCTTACTCATTACTCGAGTAATGAGTAAGCAATTGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000849.4-453s21c1
Sequence:CCGGGCCAATGGCTGGATGTGAAATCTCGAGATTTCACATCCAGCCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000849.4-639s21c1
Sequence:CCGGATTTCCGCACACAACTGATAACTCGAGTTATCAGTTGTGTGCGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000849.3-916s1c1
Sequence:CCGGGCTGAGTTTCTCTTGGGTATACTCGAGTATACCCAAGAGAAACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000849.3-618s1c1
Sequence:CCGGCTCACCTATGATATCTTGGATCTCGAGATCCAAGATATCATAGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000849.3-216s1c1
Sequence:CCGGGATACCTCTTATGAGGAGAAACTCGAGTTTCTCCTCATAAGAGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000849.3-435s1c1
Sequence:CCGGGACATCATAGAGAACCAAGTACTCGAGTACTTGGTTCTCTATGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000849.3-3622s1c1
Sequence:CCGGCCCTAATTTAACCCAGCTCATCTCGAGATGAGCTGGGTTAAATTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000849
VALIDATED
GSTM3 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase mu 3 (brain)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000849.4-479s21c1
Sequence:CCGGCTAGACCTGGACTTTCCTAATCTCGAGATTAGGAAAGTCCAGGTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000849.4-614s21c1
Sequence:CCGGGACATCATAGAGAACCAAGTACTCGAGTACTTGGTTCTCTATGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000849.4-1450s21c1
Sequence:CCGGGGGACAATTGCTTACTCATTACTCGAGTAATGAGTAAGCAATTGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000849.4-453s21c1
Sequence:CCGGGCCAATGGCTGGATGTGAAATCTCGAGATTTCACATCCAGCCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000849.4-639s21c1
Sequence:CCGGATTTCCGCACACAACTGATAACTCGAGTTATCAGTTGTGTGCGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000849.3-916s1c1
Sequence:CCGGGCTGAGTTTCTCTTGGGTATACTCGAGTATACCCAAGAGAAACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000849.3-618s1c1
Sequence:CCGGCTCACCTATGATATCTTGGATCTCGAGATCCAAGATATCATAGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000849.3-216s1c1
Sequence:CCGGGATACCTCTTATGAGGAGAAACTCGAGTTTCTCCTCATAAGAGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000849.3-435s1c1
Sequence:CCGGGACATCATAGAGAACCAAGTACTCGAGTACTTGGTTCTCTATGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000849.3-3622s1c1
Sequence:CCGGCCCTAATTTAACCCAGCTCATCTCGAGATGAGCTGGGTTAAATTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000849
VALIDATED
GSTM3 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase mu 3 (brain)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000849.4-479s21c1
Sequence:CCGGCTAGACCTGGACTTTCCTAATCTCGAGATTAGGAAAGTCCAGGTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000849.4-614s21c1
Sequence:CCGGGACATCATAGAGAACCAAGTACTCGAGTACTTGGTTCTCTATGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000849.4-1450s21c1
Sequence:CCGGGGGACAATTGCTTACTCATTACTCGAGTAATGAGTAAGCAATTGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000849.4-453s21c1
Sequence:CCGGGCCAATGGCTGGATGTGAAATCTCGAGATTTCACATCCAGCCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000849.4-639s21c1
Sequence:CCGGATTTCCGCACACAACTGATAACTCGAGTTATCAGTTGTGTGCGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149566    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000849.3-916s1c1
Sequence:CCGGGCTGAGTTTCTCTTGGGTATACTCGAGTATACCCAAGAGAAACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000849.3-618s1c1
Sequence:CCGGCTCACCTATGATATCTTGGATCTCGAGATCCAAGATATCATAGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000849.3-216s1c1
Sequence:CCGGGATACCTCTTATGAGGAGAAACTCGAGTTTCTCCTCATAAGAGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000849.3-435s1c1
Sequence:CCGGGACATCATAGAGAACCAAGTACTCGAGTACTTGGTTCTCTATGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148419    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_000849.3-3622s1c1
Sequence:CCGGCCCTAATTTAACCCAGCTCATCTCGAGATGAGCTGGGTTAAATTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)