EMAIL THIS PAGE TO A FRIEND

GSTM4

glutathione S-transferase mu 4

58 Gene Product Result for
Synonyms: GSTM4-4 GTM4
UniProtKB ID: Q03013, A8K765, Q05465, Q32NC1, Q6FH87
Gene ID:
Human(2948) Summary: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. Multiple transcript variants, each encoding a distinct protein isoform, have been identified. [provided by RefSeq, Jul 2008]
Mouse(14865) glutathione S-transferase, mu 4
Rat(499689) glutathione S-transferase mu 4
dog(479912) glutathione S-transferase mu 4
domestic cat(101100824) glutathione S-transferase mu 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS74 GST M4-4, Recombinant Human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000850 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000850 Rosetta Predictions human pricing
NM_147148 Rosetta Predictions human pricing
NM_001024304 Rosetta Predictions rat pricing
NM_026764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166677 predicted 644
2 SASI_Hs01_00166678 predicted 609
3 SASI_Hs01_00166679 predicted 647
4 SASI_Hs01_00166680 predicted 624
5 SASI_Hs01_00166681 predicted 617
6 SASI_Hs01_00166682 predicted 645
7 SASI_Hs01_00166683 predicted 1372
8 SASI_Hs01_00166684 predicted 744
9 SASI_Hs01_00166685 predicted 1313
10 SASI_Hs01_00166686 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147148 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170619 predicted 642
2 SASI_Hs01_00170620 predicted 608
3 SASI_Hs01_00170621 predicted 653
4 SASI_Hs01_00170622 predicted 631
5 SASI_Hs01_00170623 predicted 609
6 SASI_Hs01_00170624 predicted 644
7 SASI_Hs01_00170625 predicted 745
8 SASI_Hs01_00170627 predicted 741
9 SASI_Hs01_00170628 predicted 691
10 SASI_Hs01_00170626 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024304 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077073 predicted 318
2 SASI_Rn01_00077074 predicted 1102
3 SASI_Rn02_00202501 predicted 742
4 SASI_Rn01_00077075 predicted 656
5 SASI_Rn01_00077076 predicted 404
6 SASI_Rn01_00077077 predicted 953
7 SASI_Rn01_00077078 predicted 391
8 SASI_Rn02_00202502 predicted 421
9 SASI_Rn01_00077079 predicted 422
10 SASI_Rn01_00077080 predicted 984
11 SASI_Rn01_00077081 predicted 658
12 SASI_Rn01_00077082 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093413 predicted 523
2 SASI_Mm01_00093414 predicted 435
3 SASI_Mm01_00093416 predicted 451
4 SASI_Mm01_00093417 predicted 879
5 SASI_Mm01_00093418 predicted 359
6 SASI_Mm01_00093419 predicted 771
7 SASI_Mm02_00330826 predicted 467
8 SASI_Mm01_00093422 predicted 467
9 SASI_Mm02_00330827 predicted 689
10 SASI_Mm02_00330828 predicted 399
11 SASI_Mm01_00093415 predicted 435
12 SASI_Mm01_00093420 predicted 930
13 SASI_Mm01_00093421 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026764
VALIDATED
GSTM4 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase mu 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026764.2-1030s1c1
Sequence:CCGGGCTGTGCTGTTGTGAAGAGTTCTCGAGAACTCTTCACAACAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026764.2-564s1c1
Sequence:CCGGCGGACATGGTTTGTTGGTGAACTCGAGTTCACCAACAAACCATGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026764.2-524s1c1
Sequence:CCGGCCCTGGAATGGTGAAGCTCTTCTCGAGAAGAGCTTCACCATTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026764.2-407s1c1
Sequence:CCGGAGAGAAGATTCGCGTGGACATCTCGAGATGTCCACGCGAATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026764.2-704s1c1
Sequence:CCGGGAAGAGGATCTCTGCTTACATCTCGAGATGTAAGCAGAGATCCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026764.2-704s21c1
Sequence:CCGGGAAGAGGATCTCTGCTTACATCTCGAGATGTAAGCAGAGATCCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026764.2-407s21c1
Sequence:CCGGAGAGAAGATTCGCGTGGACATCTCGAGATGTCCACGCGAATCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026764.2-1030s21c1
Sequence:CCGGGCTGTGCTGTTGTGAAGAGTTCTCGAGAACTCTTCACAACAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026764.2-564s21c1
Sequence:CCGGCGGACATGGTTTGTTGGTGAACTCGAGTTCACCAACAAACCATGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026764
VALIDATED
GSTM4 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase mu 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026764.2-1030s1c1
Sequence:CCGGGCTGTGCTGTTGTGAAGAGTTCTCGAGAACTCTTCACAACAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026764.2-564s1c1
Sequence:CCGGCGGACATGGTTTGTTGGTGAACTCGAGTTCACCAACAAACCATGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026764.2-524s1c1
Sequence:CCGGCCCTGGAATGGTGAAGCTCTTCTCGAGAAGAGCTTCACCATTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026764.2-407s1c1
Sequence:CCGGAGAGAAGATTCGCGTGGACATCTCGAGATGTCCACGCGAATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026764.2-704s1c1
Sequence:CCGGGAAGAGGATCTCTGCTTACATCTCGAGATGTAAGCAGAGATCCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026764.2-704s21c1
Sequence:CCGGGAAGAGGATCTCTGCTTACATCTCGAGATGTAAGCAGAGATCCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026764.2-407s21c1
Sequence:CCGGAGAGAAGATTCGCGTGGACATCTCGAGATGTCCACGCGAATCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026764.2-1030s21c1
Sequence:CCGGGCTGTGCTGTTGTGAAGAGTTCTCGAGAACTCTTCACAACAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026764.2-564s21c1
Sequence:CCGGCGGACATGGTTTGTTGGTGAACTCGAGTTCACCAACAAACCATGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026764
VALIDATED
GSTM4 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase mu 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026764.2-1030s1c1
Sequence:CCGGGCTGTGCTGTTGTGAAGAGTTCTCGAGAACTCTTCACAACAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026764.2-564s1c1
Sequence:CCGGCGGACATGGTTTGTTGGTGAACTCGAGTTCACCAACAAACCATGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026764.2-524s1c1
Sequence:CCGGCCCTGGAATGGTGAAGCTCTTCTCGAGAAGAGCTTCACCATTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026764.2-407s1c1
Sequence:CCGGAGAGAAGATTCGCGTGGACATCTCGAGATGTCCACGCGAATCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026764.2-704s1c1
Sequence:CCGGGAAGAGGATCTCTGCTTACATCTCGAGATGTAAGCAGAGATCCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026764.2-704s21c1
Sequence:CCGGGAAGAGGATCTCTGCTTACATCTCGAGATGTAAGCAGAGATCCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026764.2-407s21c1
Sequence:CCGGAGAGAAGATTCGCGTGGACATCTCGAGATGTCCACGCGAATCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302883    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026764.2-1030s21c1
Sequence:CCGGGCTGTGCTGTTGTGAAGAGTTCTCGAGAACTCTTCACAACAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026764.2-564s21c1
Sequence:CCGGCGGACATGGTTTGTTGGTGAACTCGAGTTCACCAACAAACCATGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000850
VALIDATED
GSTM4 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase mu 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_000850.3-659s1c1
Sequence:CCGGGCCCTGACTTTGAGAAACTGACTCGAGTCAGTTTCTCAAAGTCAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_000850.3-672s1c1
Sequence:CCGGGAAACTGAAGCCAGAATACTTCTCGAGAAGTATTCTGGCTTCAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_000850.3-1066s1c1
Sequence:CCGGCGTTCCTTTCTCCTGTTTATTCTCGAGAATAAACAGGAGAAAGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000850.3-840s1c1
Sequence:CCGGCTTCCCAAATCTGAAGGACTTCTCGAGAAGTCCTTCAGATTTGGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000850.4-664s21c1
Sequence:CCGGGCCCTGACTTTGAGAAACTGACTCGAGTCAGTTTCTCAAAGTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000850.4-677s21c1
Sequence:CCGGGAAACTGAAGCCAGAATACTTCTCGAGAAGTATTCTGGCTTCAGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000850.4-1071s21c1
Sequence:CCGGCGTTCCTTTCTCCTGTTTATTCTCGAGAATAAACAGGAGAAAGGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000850.4-699s21c1
Sequence:CCGGGAGGAACTTCCTACAATGATGCTCGAGCATCATTGTAGGAAGTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000850.4-626s21c1
Sequence:CCGGTATGGACGTCTCCAATCAGCTCTCGAGAGCTGATTGGAGACGTCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000850
VALIDATED
GSTM4 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase mu 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_000850.3-659s1c1
Sequence:CCGGGCCCTGACTTTGAGAAACTGACTCGAGTCAGTTTCTCAAAGTCAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_000850.3-672s1c1
Sequence:CCGGGAAACTGAAGCCAGAATACTTCTCGAGAAGTATTCTGGCTTCAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_000850.3-1066s1c1
Sequence:CCGGCGTTCCTTTCTCCTGTTTATTCTCGAGAATAAACAGGAGAAAGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000850.3-840s1c1
Sequence:CCGGCTTCCCAAATCTGAAGGACTTCTCGAGAAGTCCTTCAGATTTGGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000850.4-664s21c1
Sequence:CCGGGCCCTGACTTTGAGAAACTGACTCGAGTCAGTTTCTCAAAGTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000850.4-677s21c1
Sequence:CCGGGAAACTGAAGCCAGAATACTTCTCGAGAAGTATTCTGGCTTCAGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000850.4-1071s21c1
Sequence:CCGGCGTTCCTTTCTCCTGTTTATTCTCGAGAATAAACAGGAGAAAGGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000850.4-699s21c1
Sequence:CCGGGAGGAACTTCCTACAATGATGCTCGAGCATCATTGTAGGAAGTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000850.4-626s21c1
Sequence:CCGGTATGGACGTCTCCAATCAGCTCTCGAGAGCTGATTGGAGACGTCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000850
VALIDATED
GSTM4 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase mu 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_000850.3-659s1c1
Sequence:CCGGGCCCTGACTTTGAGAAACTGACTCGAGTCAGTTTCTCAAAGTCAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_000850.3-672s1c1
Sequence:CCGGGAAACTGAAGCCAGAATACTTCTCGAGAAGTATTCTGGCTTCAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148357    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_000850.3-1066s1c1
Sequence:CCGGCGTTCCTTTCTCCTGTTTATTCTCGAGAATAAACAGGAGAAAGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000850.3-840s1c1
Sequence:CCGGCTTCCCAAATCTGAAGGACTTCTCGAGAAGTCCTTCAGATTTGGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000850.4-664s21c1
Sequence:CCGGGCCCTGACTTTGAGAAACTGACTCGAGTCAGTTTCTCAAAGTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000850.4-677s21c1
Sequence:CCGGGAAACTGAAGCCAGAATACTTCTCGAGAAGTATTCTGGCTTCAGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280824    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000850.4-1071s21c1
Sequence:CCGGCGTTCCTTTCTCCTGTTTATTCTCGAGAATAAACAGGAGAAAGGAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_000850.4-699s21c1
Sequence:CCGGGAGGAACTTCCTACAATGATGCTCGAGCATCATTGTAGGAAGTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000850.4-626s21c1
Sequence:CCGGTATGGACGTCTCCAATCAGCTCTCGAGAGCTGATTGGAGACGTCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)