EMAIL THIS PAGE TO A FRIEND

GSTM5

glutathione S-transferase mu 5

64 Gene Product Result for
Synonyms: GSTM5-5 GTM5
UniProtKB ID: P46439, A8K0V8, Q6PD78
Gene ID:
Human(2949) Summary: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. [provided by RefSeq, Jul 2008]
Mouse(14866) glutathione S-transferase, mu 5
Rat(64352) glutathione S-transferase, mu 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS59 GST M5-5, Recombinant Human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000851 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010360 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010360 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010360 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000851 Rosetta Predictions human pricing
NM_172038 Rosetta Predictions rat pricing
NM_010360 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234438 predicted 533
2 SASI_Hs01_00234439 predicted 701
3 SASI_Hs01_00234440 predicted 664
4 SASI_Hs01_00234441 predicted 670
5 SASI_Hs01_00234442 predicted 396
6 SASI_Hs01_00234444 predicted 667
7 SASI_Hs01_00234443 predicted 364
8 SASI_Hs01_00234445 predicted 1184
9 SASI_Hs01_00234446 predicted 620
10 SASI_Hs01_00234447 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172038 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067681 predicted 330
2 SASI_Rn01_00067683 predicted 258
3 SASI_Rn02_00269128 predicted 337
4 SASI_Rn01_00067684 predicted 380
5 SASI_Rn01_00067685 predicted 224
6 SASI_Rn01_00067686 predicted 335
7 SASI_Rn01_00067687 predicted 317
8 SASI_Rn02_00269129 predicted 437
9 SASI_Rn01_00067689 predicted 399
10 SASI_Rn01_00067690 predicted 351
11 SASI_Rn01_00067682 predicted 378
12 SASI_Rn01_00067688 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135773 predicted 586
2 SASI_Mm01_00135774 predicted 621
3 SASI_Mm01_00135775 predicted 389
4 SASI_Mm01_00135776 predicted 258
5 SASI_Mm01_00135778 predicted 587
6 SASI_Mm01_00135779 predicted 355
7 SASI_Mm01_00135780 predicted 213
8 SASI_Mm01_00135781 predicted 453
9 SASI_Mm02_00318400 predicted 473
10 SASI_Mm02_00318401 predicted 449
11 SASI_Mm01_00135777 predicted 423
12 SASI_Mm01_00135782 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000851
GSTM5 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase mu 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000851.3-706s21c1
Sequence:CCGGCAGCTACATGGAACAGCAAATCTCGAGATTTGCTGTTCCATGTAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000851.3-1179s21c1
Sequence:CCGGCTCAGGACTGTGCTCGAATTGCTCGAGCAATTCGAGCACAGTCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000851.3-410s21c1
Sequence:CCGGACTGTGCTATGACCCAGATTTCTCGAGAAATCTGGGTCATAGCACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000851.2-373s1c1
Sequence:CCGGGAACCAGGTTATGGATAACCACTCGAGTGGTTATCCATAACCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000851.2-604s1c1
Sequence:CCGGCCTAAACTTGAAGGACTTCATCTCGAGATGAAGTCCTTCAAGTTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000851.2-1140s1c1
Sequence:CCGGCCTGCCATGTCTTGTCTTATTCTCGAGAATAAGACAAGACATGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000851.2-568s1c1
Sequence:CCGGGAAGCGTATATTTGAGCCCAACTCGAGTTGGGCTCAAATATACGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000851.2-559s1c1
Sequence:CCGGCCTTGACATGAAGCGTATATTCTCGAGAATATACGCTTCATGTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000851.2-134s1c1
Sequence:CCGGGAATACACAGACTCAAGCTATCTCGAGATAGCTTGAGTCTGTGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000851
GSTM5 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase mu 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000851.3-706s21c1
Sequence:CCGGCAGCTACATGGAACAGCAAATCTCGAGATTTGCTGTTCCATGTAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000851.3-1179s21c1
Sequence:CCGGCTCAGGACTGTGCTCGAATTGCTCGAGCAATTCGAGCACAGTCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000851.3-410s21c1
Sequence:CCGGACTGTGCTATGACCCAGATTTCTCGAGAAATCTGGGTCATAGCACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000851.2-373s1c1
Sequence:CCGGGAACCAGGTTATGGATAACCACTCGAGTGGTTATCCATAACCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000851.2-604s1c1
Sequence:CCGGCCTAAACTTGAAGGACTTCATCTCGAGATGAAGTCCTTCAAGTTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000851.2-1140s1c1
Sequence:CCGGCCTGCCATGTCTTGTCTTATTCTCGAGAATAAGACAAGACATGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000851.2-568s1c1
Sequence:CCGGGAAGCGTATATTTGAGCCCAACTCGAGTTGGGCTCAAATATACGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000851.2-559s1c1
Sequence:CCGGCCTTGACATGAAGCGTATATTCTCGAGAATATACGCTTCATGTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000851.2-134s1c1
Sequence:CCGGGAATACACAGACTCAAGCTATCTCGAGATAGCTTGAGTCTGTGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000851
GSTM5 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase mu 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000851.3-706s21c1
Sequence:CCGGCAGCTACATGGAACAGCAAATCTCGAGATTTGCTGTTCCATGTAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414042    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000851.3-1179s21c1
Sequence:CCGGCTCAGGACTGTGCTCGAATTGCTCGAGCAATTCGAGCACAGTCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000851.3-410s21c1
Sequence:CCGGACTGTGCTATGACCCAGATTTCTCGAGAAATCTGGGTCATAGCACAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000851.2-373s1c1
Sequence:CCGGGAACCAGGTTATGGATAACCACTCGAGTGGTTATCCATAACCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000851.2-604s1c1
Sequence:CCGGCCTAAACTTGAAGGACTTCATCTCGAGATGAAGTCCTTCAAGTTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000851.2-1140s1c1
Sequence:CCGGCCTGCCATGTCTTGTCTTATTCTCGAGAATAAGACAAGACATGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000851.2-568s1c1
Sequence:CCGGGAAGCGTATATTTGAGCCCAACTCGAGTTGGGCTCAAATATACGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000851.2-559s1c1
Sequence:CCGGCCTTGACATGAAGCGTATATTCTCGAGAATATACGCTTCATGTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000851.2-134s1c1
Sequence:CCGGGAATACACAGACTCAAGCTATCTCGAGATAGCTTGAGTCTGTGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010360
VALIDATED
GSTM5 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase mu 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010360.2-724s21c1
Sequence:CCGGGATGCCAATCAATAACAAGATCTCGAGATCTTGTTATTGATTGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010360.2-511s21c1
Sequence:CCGGGCTGAAACAATTCTCATTGTTCTCGAGAACAATGAGAATTGTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010360.2-597s21c1
Sequence:CCGGTCTTGGATCAGAACCGTATATCTCGAGATATACGGTTCTGATCCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010360.2-453s21c1
Sequence:CCGGGCTACAATTCTAACCACGAAACTCGAGTTTCGTGGTTAGAATTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-593s1c1
Sequence:CCGGTCTTGGATCAGAACCGTATATCTCGAGATATACGGTTCTGATCCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-507s1c1
Sequence:CCGGGCTGAAACAATTCTCATTGTTCTCGAGAACAATGAGAATTGTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-720s1c1
Sequence:CCGGGATGCCAATCAATAACAAGATCTCGAGATCTTGTTATTGATTGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-449s1c1
Sequence:CCGGGCTACAATTCTAACCACGAAACTCGAGTTTCGTGGTTAGAATTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-592s1c1
Sequence:CCGGGTCTTGGATCAGAACCGTATACTCGAGTATACGGTTCTGATCCAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010360
VALIDATED
GSTM5 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase mu 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010360.2-724s21c1
Sequence:CCGGGATGCCAATCAATAACAAGATCTCGAGATCTTGTTATTGATTGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010360.2-511s21c1
Sequence:CCGGGCTGAAACAATTCTCATTGTTCTCGAGAACAATGAGAATTGTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010360.2-597s21c1
Sequence:CCGGTCTTGGATCAGAACCGTATATCTCGAGATATACGGTTCTGATCCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010360.2-453s21c1
Sequence:CCGGGCTACAATTCTAACCACGAAACTCGAGTTTCGTGGTTAGAATTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-593s1c1
Sequence:CCGGTCTTGGATCAGAACCGTATATCTCGAGATATACGGTTCTGATCCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-507s1c1
Sequence:CCGGGCTGAAACAATTCTCATTGTTCTCGAGAACAATGAGAATTGTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-720s1c1
Sequence:CCGGGATGCCAATCAATAACAAGATCTCGAGATCTTGTTATTGATTGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-449s1c1
Sequence:CCGGGCTACAATTCTAACCACGAAACTCGAGTTTCGTGGTTAGAATTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-592s1c1
Sequence:CCGGGTCTTGGATCAGAACCGTATACTCGAGTATACGGTTCTGATCCAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010360
VALIDATED
GSTM5 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase mu 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010360.2-724s21c1
Sequence:CCGGGATGCCAATCAATAACAAGATCTCGAGATCTTGTTATTGATTGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010360.2-511s21c1
Sequence:CCGGGCTGAAACAATTCTCATTGTTCTCGAGAACAATGAGAATTGTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010360.2-597s21c1
Sequence:CCGGTCTTGGATCAGAACCGTATATCTCGAGATATACGGTTCTGATCCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010360.2-453s21c1
Sequence:CCGGGCTACAATTCTAACCACGAAACTCGAGTTTCGTGGTTAGAATTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-593s1c1
Sequence:CCGGTCTTGGATCAGAACCGTATATCTCGAGATATACGGTTCTGATCCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-507s1c1
Sequence:CCGGGCTGAAACAATTCTCATTGTTCTCGAGAACAATGAGAATTGTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-720s1c1
Sequence:CCGGGATGCCAATCAATAACAAGATCTCGAGATCTTGTTATTGATTGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-449s1c1
Sequence:CCGGGCTACAATTCTAACCACGAAACTCGAGTTTCGTGGTTAGAATTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010360.1-592s1c1
Sequence:CCGGGTCTTGGATCAGAACCGTATACTCGAGTATACGGTTCTGATCCAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)