EMAIL THIS PAGE TO A FRIEND

GSTO1

glutathione S-transferase omega 1

61 Gene Product Result for
Synonyms: GSTO 1-1 GSTTLp28 P28 SPG-R
UniProtKB ID: P78417, D3DRA3, F5H7H0, Q5TA03, Q7Z3T2
Gene ID:
Human(9446) Summary: The protein encoded by this gene is an omega class glutathione S-transferase (GST) with glutathione-dependent thiol transferase and dehydroascorbate reductase activities. GSTs are involved in the metabolism of xenobiotics and carcinogens. The encoded protein acts as a homodimer and is found in the cytoplasm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(14873) glutathione S-transferase omega 1
Rat(114846) glutathione S-transferase omega 1
Zebrafish(436894) glutathione S-transferase omega 1
cow(505642) glutathione S-transferase omega 1
domestic cat(101097351) glutathione S-transferase omega 1
fruit fly(38975) Glutathione S transferase O1
dog(477813) glutathione S-transferase omega 1
chicken(423881) glutathione S-transferase omega 1
domestic guinea pig(100720637) glutathione S-transferase omega 1
naked mole-rat(101712139) glutathione S-transferase omega 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS75 GST O1-1, Recombinant Human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004832 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004832 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004832 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004832 Rosetta Predictions human pricing
NM_001007602 Rosetta Predictions rat pricing
NM_010362 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110859 predicted 301
2 SASI_Hs02_00338404 predicted 413
3 SASI_Hs01_00110860 predicted 502
4 SASI_Hs01_00110861 predicted 502
5 SASI_Hs01_00110862 predicted 489
6 SASI_Hs01_00110863 predicted 464
7 SASI_Hs01_00110864 predicted 385
8 SASI_Hs01_00110865 predicted 498
9 SASI_Hs01_00110866 predicted 343
10 SASI_Hs01_00110867 predicted 368
11 SASI_Hs01_00110868 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077318 predicted 413
2 SASI_Rn01_00077319 predicted 328
3 SASI_Rn01_00077320 predicted 412
4 SASI_Rn02_00198679 predicted 558
5 SASI_Rn01_00077321 predicted 577
6 SASI_Rn01_00077322 predicted 529
7 SASI_Rn01_00077323 predicted 389
8 SASI_Rn01_00077324 predicted 418
9 SASI_Rn01_00077325 predicted 424
10 SASI_Rn01_00077326 predicted 408
11 SASI_Rn01_00077327 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036827 predicted 756
2 SASI_Mm01_00036828 predicted 345
3 SASI_Mm01_00036830 predicted 597
4 SASI_Mm01_00036832 predicted 437
5 SASI_Mm02_00318406 predicted 854
6 SASI_Mm01_00036834 predicted 528
7 SASI_Mm01_00036835 predicted 469
8 SASI_Mm01_00036836 predicted 547
9 SASI_Mm02_00318407 predicted 825
10 SASI_Mm02_00318408 predicted 331
11 SASI_Mm01_00036829 predicted 252
12 SASI_Mm01_00036831 predicted 450
13 SASI_Mm01_00036833 predicted 421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010362
VALIDATED
GSTO1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase omega 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-559s21c1
Sequence:CCGGAGAGGAGGGCATGGATAATTACTCGAGTAATTATCCATGCCCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-240s21c1
Sequence:CCGGTCCGGCACGAAGTCATCAATACTCGAGTATTGATGACTTCGTGCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-389s21c1
Sequence:CCGGTACCCAGAGAAGAAGTTATTTCTCGAGAAATAACTTCTTCTCTGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-273s21c1
Sequence:CCGGATAAGCCCGAGTGGTTCTTTGCTCGAGCAAAGAACCACTCGGGCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-756s21c1
Sequence:CCGGAGACCTACCGCGAGTACTTAACTCGAGTTAAGTACTCGCGGTAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-899s21c1
Sequence:CCGGTGGCTCCTTTCTCATAATTTGCTCGAGCAAATTATGAGAAAGGAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010362.1-854s1c1
Sequence:CCGGCCCTCACTGATTGAATATCATCTCGAGATGATATTCAATCAGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010362.1-470s1c1
Sequence:CCGGCCGCCTTTGATTGCAAGCTTTCTCGAGAAAGCTTGCAATCAAAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010362.1-244s1c1
Sequence:CCGGGCACGAAGTCATCAACATCAACTCGAGTTGATGTTGATGACTTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010362.1-763s1c1
Sequence:CCGGCCGCGAGTACTTAAATCTCTACTCGAGTAGAGATTTAAGTACTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010362.1-605s1c1
Sequence:CCGGCCTTCTATGGTTGATTATCTTCTCGAGAAGATAATCAACCATAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010362
VALIDATED
GSTO1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase omega 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-559s21c1
Sequence:CCGGAGAGGAGGGCATGGATAATTACTCGAGTAATTATCCATGCCCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-240s21c1
Sequence:CCGGTCCGGCACGAAGTCATCAATACTCGAGTATTGATGACTTCGTGCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-389s21c1
Sequence:CCGGTACCCAGAGAAGAAGTTATTTCTCGAGAAATAACTTCTTCTCTGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-273s21c1
Sequence:CCGGATAAGCCCGAGTGGTTCTTTGCTCGAGCAAAGAACCACTCGGGCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-756s21c1
Sequence:CCGGAGACCTACCGCGAGTACTTAACTCGAGTTAAGTACTCGCGGTAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-899s21c1
Sequence:CCGGTGGCTCCTTTCTCATAATTTGCTCGAGCAAATTATGAGAAAGGAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010362.1-854s1c1
Sequence:CCGGCCCTCACTGATTGAATATCATCTCGAGATGATATTCAATCAGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010362.1-470s1c1
Sequence:CCGGCCGCCTTTGATTGCAAGCTTTCTCGAGAAAGCTTGCAATCAAAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010362.1-244s1c1
Sequence:CCGGGCACGAAGTCATCAACATCAACTCGAGTTGATGTTGATGACTTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010362.1-763s1c1
Sequence:CCGGCCGCGAGTACTTAAATCTCTACTCGAGTAGAGATTTAAGTACTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010362.1-605s1c1
Sequence:CCGGCCTTCTATGGTTGATTATCTTCTCGAGAAGATAATCAACCATAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010362
VALIDATED
GSTO1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase omega 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-559s21c1
Sequence:CCGGAGAGGAGGGCATGGATAATTACTCGAGTAATTATCCATGCCCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-240s21c1
Sequence:CCGGTCCGGCACGAAGTCATCAATACTCGAGTATTGATGACTTCGTGCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-389s21c1
Sequence:CCGGTACCCAGAGAAGAAGTTATTTCTCGAGAAATAACTTCTTCTCTGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-273s21c1
Sequence:CCGGATAAGCCCGAGTGGTTCTTTGCTCGAGCAAAGAACCACTCGGGCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-756s21c1
Sequence:CCGGAGACCTACCGCGAGTACTTAACTCGAGTTAAGTACTCGCGGTAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010362.2-899s21c1
Sequence:CCGGTGGCTCCTTTCTCATAATTTGCTCGAGCAAATTATGAGAAAGGAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010362.1-854s1c1
Sequence:CCGGCCCTCACTGATTGAATATCATCTCGAGATGATATTCAATCAGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010362.1-470s1c1
Sequence:CCGGCCGCCTTTGATTGCAAGCTTTCTCGAGAAAGCTTGCAATCAAAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010362.1-244s1c1
Sequence:CCGGGCACGAAGTCATCAACATCAACTCGAGTTGATGTTGATGACTTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010362.1-763s1c1
Sequence:CCGGCCGCGAGTACTTAAATCTCTACTCGAGTAGAGATTTAAGTACTCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010362.1-605s1c1
Sequence:CCGGCCTTCTATGGTTGATTATCTTCTCGAGAAGATAATCAACCATAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004832
VALIDATED
GSTO1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase omega 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004832.1-186s21c1
Sequence:CCGGGCCTGAGTGGTTCTTTAAGAACTCGAGTTCTTAAAGAACCACTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004832.1-383s21c1
Sequence:CCGGCCTTGGTAGGAAGCTTTATTACTCGAGTAATAAAGCTTCCTACCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004832.1-340s21c1
Sequence:CCGGGCTTGCCAGAAGATGATCTTACTCGAGTAAGATCATCTTCTGGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004832.1-556s1c1
Sequence:CCGGCGGCTGGAAGCAATGAAGTTACTCGAGTAACTTCATTGCTTCCAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004832.1-497s1c1
Sequence:CCGGCCTTCTTTGGTGGCAATTCTACTCGAGTAGAATTGCCACCAAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004832.1-186s1c1
Sequence:CCGGGCCTGAGTGGTTCTTTAAGAACTCGAGTTCTTAAAGAACCACTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004832.1-383s1c1
Sequence:CCGGCCTTGGTAGGAAGCTTTATTACTCGAGTAATAAAGCTTCCTACCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004832.1-480s1c1
Sequence:CCGGGACTAATAAGAAGACGACCTTCTCGAGAAGGTCGTCTTCTTATTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004832.1-573s1c1
Sequence:CCGGGTTAAATGAGTGTGTAGACCACTCGAGTGGTCTACACACTCATTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004832.1-558s1c1
Sequence:CCGGGCTGGAAGCAATGAAGTTAAACTCGAGTTTAACTTCATTGCTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004832.1-344s1c1
Sequence:CCGGGCCAGAAGATGATCTTAGAGTCTCGAGACTCTAAGATCATCTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004832.1-340s1c1
Sequence:CCGGGCTTGCCAGAAGATGATCTTACTCGAGTAAGATCATCTTCTGGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004832
VALIDATED
GSTO1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase omega 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004832.1-186s21c1
Sequence:CCGGGCCTGAGTGGTTCTTTAAGAACTCGAGTTCTTAAAGAACCACTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004832.1-383s21c1
Sequence:CCGGCCTTGGTAGGAAGCTTTATTACTCGAGTAATAAAGCTTCCTACCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004832.1-340s21c1
Sequence:CCGGGCTTGCCAGAAGATGATCTTACTCGAGTAAGATCATCTTCTGGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004832.1-556s1c1
Sequence:CCGGCGGCTGGAAGCAATGAAGTTACTCGAGTAACTTCATTGCTTCCAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004832.1-497s1c1
Sequence:CCGGCCTTCTTTGGTGGCAATTCTACTCGAGTAGAATTGCCACCAAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004832.1-186s1c1
Sequence:CCGGGCCTGAGTGGTTCTTTAAGAACTCGAGTTCTTAAAGAACCACTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004832.1-383s1c1
Sequence:CCGGCCTTGGTAGGAAGCTTTATTACTCGAGTAATAAAGCTTCCTACCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004832.1-480s1c1
Sequence:CCGGGACTAATAAGAAGACGACCTTCTCGAGAAGGTCGTCTTCTTATTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004832.1-573s1c1
Sequence:CCGGGTTAAATGAGTGTGTAGACCACTCGAGTGGTCTACACACTCATTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004832.1-558s1c1
Sequence:CCGGGCTGGAAGCAATGAAGTTAAACTCGAGTTTAACTTCATTGCTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004832.1-344s1c1
Sequence:CCGGGCCAGAAGATGATCTTAGAGTCTCGAGACTCTAAGATCATCTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004832.1-340s1c1
Sequence:CCGGGCTTGCCAGAAGATGATCTTACTCGAGTAAGATCATCTTCTGGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004832
VALIDATED
GSTO1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase omega 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004832.1-186s21c1
Sequence:CCGGGCCTGAGTGGTTCTTTAAGAACTCGAGTTCTTAAAGAACCACTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004832.1-383s21c1
Sequence:CCGGCCTTGGTAGGAAGCTTTATTACTCGAGTAATAAAGCTTCCTACCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004832.1-340s21c1
Sequence:CCGGGCTTGCCAGAAGATGATCTTACTCGAGTAAGATCATCTTCTGGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004832.1-556s1c1
Sequence:CCGGCGGCTGGAAGCAATGAAGTTACTCGAGTAACTTCATTGCTTCCAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004832.1-497s1c1
Sequence:CCGGCCTTCTTTGGTGGCAATTCTACTCGAGTAGAATTGCCACCAAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004832.1-186s1c1
Sequence:CCGGGCCTGAGTGGTTCTTTAAGAACTCGAGTTCTTAAAGAACCACTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004832.1-383s1c1
Sequence:CCGGCCTTGGTAGGAAGCTTTATTACTCGAGTAATAAAGCTTCCTACCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_004832.1-480s1c1
Sequence:CCGGGACTAATAAGAAGACGACCTTCTCGAGAAGGTCGTCTTCTTATTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004832.1-573s1c1
Sequence:CCGGGTTAAATGAGTGTGTAGACCACTCGAGTGGTCTACACACTCATTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004832.1-558s1c1
Sequence:CCGGGCTGGAAGCAATGAAGTTAAACTCGAGTTTAACTTCATTGCTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004832.1-344s1c1
Sequence:CCGGGCCAGAAGATGATCTTAGAGTCTCGAGACTCTAAGATCATCTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004832.1-340s1c1
Sequence:CCGGGCTTGCCAGAAGATGATCTTACTCGAGTAAGATCATCTTCTGGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)