EMAIL THIS PAGE TO A FRIEND

GSTO2

glutathione S-transferase omega 2

67 Gene Product Result for
Synonyms: GSTO 2-2 bA127L20.1
Gene ID:
Human(119391) Summary: The protein encoded by this gene is an omega class glutathione S-transferase (GST). GSTs are involved in the metabolism of xenobiotics and carcinogens. Four transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jul 2010]
Mouse(68214) glutathione S-transferase omega 2
Rat(309465) glutathione S-transferase omega 2
domestic guinea pig(100720364) glutathione S-transferase omega 2
naked mole-rat(101712717) glutathione S-transferase omega 2
sheep(101115496) glutathione S-transferase omega 2
Zebrafish(492500) glutathione S-transferase omega 2
cow(613905) glutathione S-transferase omega 2
domestic cat(101090141) glutathione S-transferase omega 2
dog(477814) glutathione S-transferase omega 2
fruit fly(38974) Glutathione S transferase O2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS76 GST O2-2, Recombinant Human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_183239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_183239 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026619 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026619 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026619 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_183239 Rosetta Predictions human pricing
NM_001012071 Rosetta Predictions rat pricing
XM_574684 Rosetta Predictions rat pricing
NM_026619 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105832 predicted 864
2 SASI_Hs01_00105833 predicted 769
3 SASI_Hs01_00105834 predicted 1255
4 SASI_Hs01_00105835 predicted 1127
5 SASI_Hs01_00105836 predicted 770
6 SASI_Hs01_00105837 predicted 1136
7 SASI_Hs01_00105838 predicted 960
8 SASI_Hs01_00105839 predicted 1174
9 SASI_Hs01_00105841 predicted 749
10 SASI_Hs02_00371238 predicted 1186
11 SASI_Hs01_00105840 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063325 predicted 729
2 SASI_Rn01_00063326 predicted 555
3 SASI_Rn01_00063327 predicted 998
4 SASI_Rn01_00063329 predicted 757
5 SASI_Rn01_00063330 predicted 749
6 SASI_Rn01_00063331 predicted 956
7 SASI_Rn01_00063332 predicted 999
8 SASI_Rn01_00063333 predicted 627
9 SASI_Rn01_00063334 predicted 851
10 SASI_Rn02_00200182 predicted 740
11 SASI_Rn01_00063328 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149598 predicted 755
2 SASI_Rn01_00149599 predicted 591
3 SASI_Rn01_00149600 predicted 1031
4 SASI_Rn01_00149601 predicted 831
5 SASI_Rn01_00149602 predicted 797
6 SASI_Rn01_00149603 predicted 785
7 SASI_Rn01_00149604 predicted 983
8 SASI_Rn01_00149605 predicted 1029
9 SASI_Rn01_00149606 predicted 667
10 SASI_Rn01_00149607 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076911 predicted 614
2 SASI_Mm01_00076912 predicted 605
3 SASI_Mm01_00076913 predicted 569
4 SASI_Mm01_00076914 predicted 730
5 SASI_Mm02_00330582 predicted 1036
6 SASI_Mm01_00076916 predicted 937
7 SASI_Mm01_00076917 predicted 723
8 SASI_Mm01_00076918 predicted 572
9 SASI_Mm01_00076919 predicted 674
10 SASI_Mm01_00076920 predicted 886
11 SASI_Mm01_00076915 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183239
VALIDATED
GSTO2 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase omega 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-858s1c1
Sequence:CCGGCCAGCCAATGTCAACTGATCTCTCGAGAGATCAGTTGACATTGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-758s1c1
Sequence:CCGGGCCAAAGACATCAGACATGAACTCGAGTTCATGTCTGATGTCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1327s1c1
Sequence:CCGGCAACCCTAATGCCTTTGACTTCTCGAGAAGTCAAAGGCATTAGGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1134s1c1
Sequence:CCGGCCTGTATATCCATGATTGATTCTCGAGAATCAATCATGGATATACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1143s1c1
Sequence:CCGGCCATGATTGATTACCTCCTCTCTCGAGAGAGGAGGTAATCAATCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-869s1c1
Sequence:CCGGCAACTGATCTATGAATCTGTTCTCGAGAACAGATTCATAGATCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1298s1c1
Sequence:CCGGCAGGGCTTCTTGAATCTCTATCTCGAGATAGAGATTCAAGAAGCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-769s1c1
Sequence:CCGGCAGACATGAAGTGGTCAACATCTCGAGATGTTGACCACTTCATGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1231s1c1
Sequence:CCGGGCTCTGGATATCAGCCATGAACTCGAGTTCATGGCTGATATCCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183239
VALIDATED
GSTO2 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase omega 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-858s1c1
Sequence:CCGGCCAGCCAATGTCAACTGATCTCTCGAGAGATCAGTTGACATTGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-758s1c1
Sequence:CCGGGCCAAAGACATCAGACATGAACTCGAGTTCATGTCTGATGTCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1327s1c1
Sequence:CCGGCAACCCTAATGCCTTTGACTTCTCGAGAAGTCAAAGGCATTAGGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1134s1c1
Sequence:CCGGCCTGTATATCCATGATTGATTCTCGAGAATCAATCATGGATATACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1143s1c1
Sequence:CCGGCCATGATTGATTACCTCCTCTCTCGAGAGAGGAGGTAATCAATCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-869s1c1
Sequence:CCGGCAACTGATCTATGAATCTGTTCTCGAGAACAGATTCATAGATCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1298s1c1
Sequence:CCGGCAGGGCTTCTTGAATCTCTATCTCGAGATAGAGATTCAAGAAGCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-769s1c1
Sequence:CCGGCAGACATGAAGTGGTCAACATCTCGAGATGTTGACCACTTCATGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1231s1c1
Sequence:CCGGGCTCTGGATATCAGCCATGAACTCGAGTTCATGGCTGATATCCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183239
VALIDATED
GSTO2 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase omega 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-858s1c1
Sequence:CCGGCCAGCCAATGTCAACTGATCTCTCGAGAGATCAGTTGACATTGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-758s1c1
Sequence:CCGGGCCAAAGACATCAGACATGAACTCGAGTTCATGTCTGATGTCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1327s1c1
Sequence:CCGGCAACCCTAATGCCTTTGACTTCTCGAGAAGTCAAAGGCATTAGGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1134s1c1
Sequence:CCGGCCTGTATATCCATGATTGATTCTCGAGAATCAATCATGGATATACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1143s1c1
Sequence:CCGGCCATGATTGATTACCTCCTCTCTCGAGAGAGGAGGTAATCAATCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-869s1c1
Sequence:CCGGCAACTGATCTATGAATCTGTTCTCGAGAACAGATTCATAGATCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1298s1c1
Sequence:CCGGCAGGGCTTCTTGAATCTCTATCTCGAGATAGAGATTCAAGAAGCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-769s1c1
Sequence:CCGGCAGACATGAAGTGGTCAACATCTCGAGATGTTGACCACTTCATGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_183239.1-1231s1c1
Sequence:CCGGGCTCTGGATATCAGCCATGAACTCGAGTTCATGGCTGATATCCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026619
VALIDATED
GSTO2 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase omega 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026619.1-1082s1c1
Sequence:CCGGGCACACTGATAAGAGCGTCTTCTCGAGAAGACGCTCTTATCAGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026619.1-773s1c1
Sequence:CCGGGAAGATGTTATTGGAGCTATTCTCGAGAATAGCTCCAATAACATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026619.1-678s1c1
Sequence:CCGGCTGGTCTATGAATCTGTCATTCTCGAGAATGACAGATTCATAGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026619.1-611s1c1
Sequence:CCGGGCCTGACTGGTACTATACAAACTCGAGTTTGTATAGTACCAGTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026619.1-804s1c1
Sequence:CCGGCCGCCTTTAAGCAAGGAATGTCTCGAGACATTCCTTGCTTAAAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026619
VALIDATED
GSTO2 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase omega 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026619.1-1082s1c1
Sequence:CCGGGCACACTGATAAGAGCGTCTTCTCGAGAAGACGCTCTTATCAGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026619.1-773s1c1
Sequence:CCGGGAAGATGTTATTGGAGCTATTCTCGAGAATAGCTCCAATAACATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026619.1-678s1c1
Sequence:CCGGCTGGTCTATGAATCTGTCATTCTCGAGAATGACAGATTCATAGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026619.1-611s1c1
Sequence:CCGGGCCTGACTGGTACTATACAAACTCGAGTTTGTATAGTACCAGTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026619.1-804s1c1
Sequence:CCGGCCGCCTTTAAGCAAGGAATGTCTCGAGACATTCCTTGCTTAAAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026619
VALIDATED
GSTO2 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase omega 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026619.1-1082s1c1
Sequence:CCGGGCACACTGATAAGAGCGTCTTCTCGAGAAGACGCTCTTATCAGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026619.1-773s1c1
Sequence:CCGGGAAGATGTTATTGGAGCTATTCTCGAGAATAGCTCCAATAACATCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026619.1-678s1c1
Sequence:CCGGCTGGTCTATGAATCTGTCATTCTCGAGAATGACAGATTCATAGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026619.1-611s1c1
Sequence:CCGGGCCTGACTGGTACTATACAAACTCGAGTTTGTATAGTACCAGTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026619.1-804s1c1
Sequence:CCGGCCGCCTTTAAGCAAGGAATGTCTCGAGACATTCCTTGCTTAAAGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)