EMAIL THIS PAGE TO A FRIEND

GSTP1

glutathione S-transferase pi 1

81 Gene Product Result for
Synonyms: DFN7 FAEES3 GST3 GSTP PI
UniProtKB ID: P09211, O00460, Q15690, Q5TZY3
Gene ID:
Human(2950) Summary: Glutathione S-transferases (GSTs) are a family of enzymes that play an important role in detoxification by catalyzing the conjugation of many hydrophobic and electrophilic compounds with reduced glutathione. Based on their biochemical, immunologic, and structural properties, the soluble GSTs are categorized into 4 main classes: alpha, mu, pi, and theta. This GST family member is a polymorphic gene encoding active, functionally different GSTP1 variant proteins that are thought to function in xenobiotic metabolism and play a role in susceptibility to cancer, and other diseases. [provided by RefSeq, Jul 2008]
Mouse(14870) glutathione S-transferase, pi 1
Rat(24426) glutathione S-transferase pi 1
naked mole-rat(101712988) glutathione S-transferase pi 1
Goat(100861197) glutathione S-transferase pi 1
sheep(101120616) glutathione S-transferase pi 1
Zebrafish(79381) glutathione S-transferase pi 1
dog(476005) glutathione S-transferase pi 1
cow(281806) glutathione S-transferase pi 1
domestic cat(101082184) glutathione S-transferase pi 1
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500496 Anti-GST3/GSTP1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, canine, human, mouse
ELISA, western blot pricing
SAB1100246 Anti-GSTP1 (51-65) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA019779 Anti-GSTP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunohistochemistry, western blot pricing
HPA019869 Anti-GSTP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500265 Anti-GSTP1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0002950M1 Monoclonal Anti-GSTP1 antibody produced in mouse clone 2G6-F6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1403891 Monoclonal Anti-GSTP1 antibody produced in mouse clone S1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB5300454 Monoclonal Anti-GSTP1 antibody produced in mouse clone 3F2C2, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

Cell Lines

Product # Description Species Add to Cart
 
GS70 GST P1-1, Recombinant Human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000852 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000852 Rosetta Predictions human pricing
NM_012577 Rosetta Predictions rat pricing
XM_579338 Rosetta Predictions rat pricing
NM_013541 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089970 predicted 206
2 SASI_Hs01_00089971 predicted 218
3 SASI_Hs01_00089972 predicted 200
4 SASI_Hs01_00089973 predicted 498
5 SASI_Hs01_00089974 predicted 475
6 SASI_Hs01_00089976 predicted 323
7 SASI_Hs01_00089977 predicted 258
8 SASI_Hs01_00089978 predicted 472
9 SASI_Hs02_00303359 predicted 461
10 SASI_Hs02_00303360 predicted 491
11 SASI_Hs01_00089975 predicted 356
12 SASI_Hs01_00089979 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080772 predicted 395
2 SASI_Rn01_00080773 predicted 383
3 SASI_Rn02_00259705 predicted 395
4 SASI_Rn02_00259706 predicted 321
5 SASI_Rn01_00080775 predicted 374
6 SASI_Rn02_00259707 predicted 491
7 SASI_Rn02_00259708 predicted 238
8 SASI_Rn01_00080779 predicted 397
9 SASI_Rn02_00259709 predicted 507
10 SASI_Rn02_00259710 predicted 372
11 SASI_Rn01_00080774 predicted 366
12 SASI_Rn01_00080776 predicted 211
13 SASI_Rn01_00080777 predicted 293
14 SASI_Rn01_00080778 predicted 216
15 SASI_Rn01_00080780 predicted 396
16 SASI_Rn01_00080781 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00187683 predicted 323
2 SASI_Rn01_00187684 predicted 315
3 SASI_Rn01_00187685 predicted 367
4 SASI_Rn01_00187686 predicted 316
5 SASI_Rn01_00187687 predicted 210
6 SASI_Rn01_00187688 predicted 297
7 SASI_Rn01_00187689 predicted 217
8 SASI_Rn01_00187690 predicted 331
9 SASI_Rn01_00187691 predicted 386
10 SASI_Rn01_00187692 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322245 predicted 357
2 SASI_Mm02_00322246 predicted 345
3 SASI_Mm02_00322247 predicted 359
4 SASI_Mm01_00065108 predicted 493
5 SASI_Mm01_00065109 predicted 377
6 SASI_Mm01_00065110 predicted 308
7 SASI_Mm01_00065111 predicted 223
8 SASI_Mm01_00065112 predicted 341
9 SASI_Mm01_00065113 predicted 382
10 SASI_Mm01_00065114 predicted 240
11 SASI_Mm01_00065115 predicted 242
12 SASI_Mm01_00065116 predicted 390
13 SASI_Mm01_00065117 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000852
VALIDATED
GSTP1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase pi 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-727s21c1
Sequence:CCGGCTGCTGATCCATGAGGTCCTACTCGAGTAGGACCTCATGGATCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-429s21c1
Sequence:CCGGCCTCACCCTGTACCAGTCCAACTCGAGTTGGACTGGTACAGGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000852.3-702s21c1
Sequence:CCGGCGCTGACTACAACCTGCTGGACTCGAGTCCAGCAGGTTGTAGTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-158s1c1
Sequence:CCGGACTCAAAGCCTCCTGCCTATACTCGAGTATAGGCAGGAGGCTTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-332s1c1
Sequence:CCGGCTGCAAATACATCTCCCTCATCTCGAGATGAGGGAGATGTATTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-209s1c1
Sequence:CCGGCCTCACCCTGTACCAGTCCAACTCGAGTTGGACTGGTACAGGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-331s1c1
Sequence:CCGGGCTGCAAATACATCTCCCTCACTCGAGTGAGGGAGATGTATTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-482s1c1
Sequence:CCGGCGCTGACTACAACCTGCTGGACTCGAGTCCAGCAGGTTGTAGTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-513s21c1
Sequence:CCGGCCTGGTGGACATGGTGAATGACTCGAGTCATTCACCATGTCCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-677s21c1
Sequence:CCGGTCATTGTGGGAGACCAGATCTCTCGAGAGATCTGGTCTCCCACAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-551s21c1
Sequence:CCGGGCTGCAAATACATCTCCCTCACTCGAGTGAGGGAGATGTATTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000852
VALIDATED
GSTP1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase pi 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-727s21c1
Sequence:CCGGCTGCTGATCCATGAGGTCCTACTCGAGTAGGACCTCATGGATCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-429s21c1
Sequence:CCGGCCTCACCCTGTACCAGTCCAACTCGAGTTGGACTGGTACAGGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000852.3-702s21c1
Sequence:CCGGCGCTGACTACAACCTGCTGGACTCGAGTCCAGCAGGTTGTAGTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-158s1c1
Sequence:CCGGACTCAAAGCCTCCTGCCTATACTCGAGTATAGGCAGGAGGCTTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-332s1c1
Sequence:CCGGCTGCAAATACATCTCCCTCATCTCGAGATGAGGGAGATGTATTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-209s1c1
Sequence:CCGGCCTCACCCTGTACCAGTCCAACTCGAGTTGGACTGGTACAGGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-331s1c1
Sequence:CCGGGCTGCAAATACATCTCCCTCACTCGAGTGAGGGAGATGTATTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-482s1c1
Sequence:CCGGCGCTGACTACAACCTGCTGGACTCGAGTCCAGCAGGTTGTAGTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-513s21c1
Sequence:CCGGCCTGGTGGACATGGTGAATGACTCGAGTCATTCACCATGTCCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-677s21c1
Sequence:CCGGTCATTGTGGGAGACCAGATCTCTCGAGAGATCTGGTCTCCCACAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-551s21c1
Sequence:CCGGGCTGCAAATACATCTCCCTCACTCGAGTGAGGGAGATGTATTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000852
VALIDATED
GSTP1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase pi 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-727s21c1
Sequence:CCGGCTGCTGATCCATGAGGTCCTACTCGAGTAGGACCTCATGGATCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-429s21c1
Sequence:CCGGCCTCACCCTGTACCAGTCCAACTCGAGTTGGACTGGTACAGGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000852.3-702s21c1
Sequence:CCGGCGCTGACTACAACCTGCTGGACTCGAGTCCAGCAGGTTGTAGTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-158s1c1
Sequence:CCGGACTCAAAGCCTCCTGCCTATACTCGAGTATAGGCAGGAGGCTTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-332s1c1
Sequence:CCGGCTGCAAATACATCTCCCTCATCTCGAGATGAGGGAGATGTATTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-209s1c1
Sequence:CCGGCCTCACCCTGTACCAGTCCAACTCGAGTTGGACTGGTACAGGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-331s1c1
Sequence:CCGGGCTGCAAATACATCTCCCTCACTCGAGTGAGGGAGATGTATTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000852.2-482s1c1
Sequence:CCGGCGCTGACTACAACCTGCTGGACTCGAGTCCAGCAGGTTGTAGTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-513s21c1
Sequence:CCGGCCTGGTGGACATGGTGAATGACTCGAGTCATTCACCATGTCCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-677s21c1
Sequence:CCGGTCATTGTGGGAGACCAGATCTCTCGAGAGATCTGGTCTCCCACAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_000852.3-551s21c1
Sequence:CCGGGCTGCAAATACATCTCCCTCACTCGAGTGAGGGAGATGTATTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013541
VALIDATED
GSTP1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase pi 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-352s21c1
Sequence:CCGGCGGCAAATATGTCACCCTCATCTCGAGATGAGGGTGACATATTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-490s21c1
Sequence:CCGGCCAGATCTCCTTTGCCGATTACTCGAGTAATCGGCAAAGGAGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-311s21c1
Sequence:CCGGGCCCAGATGGATATGGTGAATCTCGAGATTCACCATATCCATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013541.1-490s1c1
Sequence:CCGGCCAGATCTCCTTTGCCGATTACTCGAGTAATCGGCAAAGGAGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-376s21c1
Sequence:CCGGCACCAACTATGAGAATGGTAACTCGAGTTACCATTCTCATAGTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-235s21c1
Sequence:CCGGCCTTTACCAATCTAATGCCATCTCGAGATGGCATTAGATTGGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013541.1-352s1c1
Sequence:CCGGCGGCAAATATGTCACCCTCATCTCGAGATGAGGGTGACATATTTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013541.1-235s1c1
Sequence:CCGGCCTTTACCAATCTAATGCCATCTCGAGATGGCATTAGATTGGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013541.1-376s1c1
Sequence:CCGGCACCAACTATGAGAATGGTAACTCGAGTTACCATTCTCATAGTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013541.1-311s1c1
Sequence:CCGGGCCCAGATGGATATGGTGAATCTCGAGATTCACCATATCCATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013541
VALIDATED
GSTP1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase pi 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-352s21c1
Sequence:CCGGCGGCAAATATGTCACCCTCATCTCGAGATGAGGGTGACATATTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-490s21c1
Sequence:CCGGCCAGATCTCCTTTGCCGATTACTCGAGTAATCGGCAAAGGAGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-311s21c1
Sequence:CCGGGCCCAGATGGATATGGTGAATCTCGAGATTCACCATATCCATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013541.1-490s1c1
Sequence:CCGGCCAGATCTCCTTTGCCGATTACTCGAGTAATCGGCAAAGGAGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-376s21c1
Sequence:CCGGCACCAACTATGAGAATGGTAACTCGAGTTACCATTCTCATAGTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-235s21c1
Sequence:CCGGCCTTTACCAATCTAATGCCATCTCGAGATGGCATTAGATTGGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013541.1-352s1c1
Sequence:CCGGCGGCAAATATGTCACCCTCATCTCGAGATGAGGGTGACATATTTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013541.1-235s1c1
Sequence:CCGGCCTTTACCAATCTAATGCCATCTCGAGATGGCATTAGATTGGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013541.1-376s1c1
Sequence:CCGGCACCAACTATGAGAATGGTAACTCGAGTTACCATTCTCATAGTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013541.1-311s1c1
Sequence:CCGGGCCCAGATGGATATGGTGAATCTCGAGATTCACCATATCCATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013541
VALIDATED
GSTP1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase pi 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-352s21c1
Sequence:CCGGCGGCAAATATGTCACCCTCATCTCGAGATGAGGGTGACATATTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-490s21c1
Sequence:CCGGCCAGATCTCCTTTGCCGATTACTCGAGTAATCGGCAAAGGAGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-311s21c1
Sequence:CCGGGCCCAGATGGATATGGTGAATCTCGAGATTCACCATATCCATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013541.1-490s1c1
Sequence:CCGGCCAGATCTCCTTTGCCGATTACTCGAGTAATCGGCAAAGGAGATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-376s21c1
Sequence:CCGGCACCAACTATGAGAATGGTAACTCGAGTTACCATTCTCATAGTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013541.1-235s21c1
Sequence:CCGGCCTTTACCAATCTAATGCCATCTCGAGATGGCATTAGATTGGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013541.1-352s1c1
Sequence:CCGGCGGCAAATATGTCACCCTCATCTCGAGATGAGGGTGACATATTTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013541.1-235s1c1
Sequence:CCGGCCTTTACCAATCTAATGCCATCTCGAGATGGCATTAGATTGGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013541.1-376s1c1
Sequence:CCGGCACCAACTATGAGAATGGTAACTCGAGTTACCATTCTCATAGTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013541.1-311s1c1
Sequence:CCGGGCCCAGATGGATATGGTGAATCTCGAGATTCACCATATCCATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)