EMAIL THIS PAGE TO A FRIEND

GSTT1

glutathione S-transferase theta 1

63 Gene Product Result for
UniProtKB ID: P30711, O00226, Q5TZY2, Q969K8, Q96IY3
Gene ID:
Human(2952) Summary: Glutathione S-transferase (GST) theta 1 (GSTT1) is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: alpha, mu, pi, theta, and zeta. The theta class includes GSTT1 and GSTT2. The GSTT1 and GSTT2 share 55% amino acid sequence identity and both of them were claimed to have an important role in human carcinogenesis. The GSTT1 gene is located approximately 50kb away from the GSTT2 gene. The GSTT1 and GSTT2 genes have a similar structure, being composed of five exons with identical exon/intron boundaries. [provided by RefSeq, Jul 2008]
Mouse(14871) glutathione S-transferase, theta 1
Rat(25260) glutathione S-transferase theta 1
fruit fly(35995) Glutathione S transferase T1
Thale Cress(834123) glutathione S-transferase THETA 1
cow(517724) glutathione S-transferase theta 1
dog(477556) glutathione S-transferase theta 1
chicken(396322) glutathione S-transferase theta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS90 GST T1-1, Recombinant Human human pricing
GS38 GST T1-1, Recombinant Rat rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000853 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000853 Rosetta Predictions human pricing
NM_053293 Rosetta Predictions rat pricing
NM_008185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145753 predicted 537
2 SASI_Hs01_00145754 predicted 260
3 SASI_Hs02_00303361 predicted 783
4 SASI_Hs02_00303362 predicted 793
5 SASI_Hs02_00303363 predicted 232
6 SASI_Hs02_00303364 predicted 257
7 SASI_Hs01_00145759 predicted 384
8 SASI_Hs01_00145757 predicted 685
9 SASI_Hs02_00303365 predicted 388
10 SASI_Hs01_00145760 predicted 561
11 SASI_Hs01_00145755 predicted 440
12 SASI_Hs01_00145756 predicted 566
13 SASI_Hs01_00145758 predicted 624
14 SASI_Hs01_00145761 predicted 751
15 SASI_Hs01_00145762 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043268 predicted 429
2 SASI_Rn01_00043269 predicted 204
3 SASI_Rn02_00265669 predicted 538
4 SASI_Rn01_00043271 predicted 235
5 SASI_Rn01_00043272 predicted 537
6 SASI_Rn01_00043273 predicted 543
7 SASI_Rn01_00043275 predicted 436
8 SASI_Rn01_00043276 predicted 441
9 SASI_Rn02_00265670 predicted 219
10 SASI_Rn02_00265671 predicted 233
11 SASI_Rn01_00043267 predicted 241
12 SASI_Rn01_00043270 predicted 481
13 SASI_Rn01_00043274 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040700 predicted 803
2 SASI_Mm01_00040701 predicted 750
3 SASI_Mm01_00040692 predicted 267
4 SASI_Mm01_00040693 predicted 299
5 SASI_Mm01_00040694 predicted 272
6 SASI_Mm02_00313326 predicted 755
7 SASI_Mm02_00313327 predicted 708
8 SASI_Mm02_00313328 predicted 791
9 SASI_Mm02_00313329 predicted 488
10 SASI_Mm01_00040696 predicted 296
11 SASI_Mm01_00040695 predicted 265
12 SASI_Mm01_00040697 predicted 273
13 SASI_Mm01_00040698 predicted 256
14 SASI_Mm01_00040699 predicted 259
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008185
GSTT1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase theta 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008185.2-849s1c1
Sequence:CCGGCACAACTCACAGTTCACAATTCTCGAGAATTGTGAACTGTGAGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008185.2-133s1c1
Sequence:CCGGCGCCATTTATATCTTCGCCAACTCGAGTTGGCGAAGATATAAATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008185.2-427s1c1
Sequence:CCGGCCTGTGGCATAAGGTGATGTTCTCGAGAACATCACCTTATGCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008185.2-760s1c1
Sequence:CCGGCCTCATCATAAAGCAGAAGCTCTCGAGAGCTTCTGCTTTATGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008185.2-135s1c1
Sequence:CCGGCCATTTATATCTTCGCCAAGACTCGAGTCTTGGCGAAGATATAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008185
GSTT1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase theta 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008185.2-849s1c1
Sequence:CCGGCACAACTCACAGTTCACAATTCTCGAGAATTGTGAACTGTGAGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008185.2-133s1c1
Sequence:CCGGCGCCATTTATATCTTCGCCAACTCGAGTTGGCGAAGATATAAATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008185.2-427s1c1
Sequence:CCGGCCTGTGGCATAAGGTGATGTTCTCGAGAACATCACCTTATGCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008185.2-760s1c1
Sequence:CCGGCCTCATCATAAAGCAGAAGCTCTCGAGAGCTTCTGCTTTATGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008185.2-135s1c1
Sequence:CCGGCCATTTATATCTTCGCCAAGACTCGAGTCTTGGCGAAGATATAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008185
GSTT1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase theta 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103355    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008185.2-849s1c1
Sequence:CCGGCACAACTCACAGTTCACAATTCTCGAGAATTGTGAACTGTGAGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008185.2-133s1c1
Sequence:CCGGCGCCATTTATATCTTCGCCAACTCGAGTTGGCGAAGATATAAATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008185.2-427s1c1
Sequence:CCGGCCTGTGGCATAAGGTGATGTTCTCGAGAACATCACCTTATGCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008185.2-760s1c1
Sequence:CCGGCCTCATCATAAAGCAGAAGCTCTCGAGAGCTTCTGCTTTATGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008185.2-135s1c1
Sequence:CCGGCCATTTATATCTTCGCCAAGACTCGAGTCTTGGCGAAGATATAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000853
GSTT1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase theta 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000853.1-115s1c1
Sequence:CCGGCAGCACTTAAGCGATGCCTTTCTCGAGAAAGGCATCGCTTAAGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000853.1-102s1c1
Sequence:CCGGTCTGATTAAAGGTCAGCACTTCTCGAGAAGTGCTGACCTTTAATCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000853.1-225s1c1
Sequence:CCGGGCGCAAATATAAGGTCCCTGACTCGAGTCAGGGACCTTATATTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000853.1-57s1c1
Sequence:CCGGCTTTGCCAAGAAGAACGACATCTCGAGATGTCGTTCTTCTTGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000853.1-818s1c1
Sequence:CCGGGCTTGCTTAAGACTTGCCCAACTCGAGTTGGGCAAGTCTTAAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000853.2-389s21c1
Sequence:CCGGGGCCTTGTGGCATAAGGTGATCTCGAGATCACCTTATGCCACAAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000853.2-235s21c1
Sequence:CCGGACTTCACCTTGACGGAGAGTGCTCGAGCACTCTCCGTCAAGGTGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000853.2-861s21c1
Sequence:CCGGAGCAGGAATGGCTTGCCTAAGCTCGAGCTTAGGCAAGCCATTCCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000853
GSTT1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase theta 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000853.1-115s1c1
Sequence:CCGGCAGCACTTAAGCGATGCCTTTCTCGAGAAAGGCATCGCTTAAGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000853.1-102s1c1
Sequence:CCGGTCTGATTAAAGGTCAGCACTTCTCGAGAAGTGCTGACCTTTAATCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000853.1-225s1c1
Sequence:CCGGGCGCAAATATAAGGTCCCTGACTCGAGTCAGGGACCTTATATTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000853.1-57s1c1
Sequence:CCGGCTTTGCCAAGAAGAACGACATCTCGAGATGTCGTTCTTCTTGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000853.1-818s1c1
Sequence:CCGGGCTTGCTTAAGACTTGCCCAACTCGAGTTGGGCAAGTCTTAAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000853.2-389s21c1
Sequence:CCGGGGCCTTGTGGCATAAGGTGATCTCGAGATCACCTTATGCCACAAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000853.2-235s21c1
Sequence:CCGGACTTCACCTTGACGGAGAGTGCTCGAGCACTCTCCGTCAAGGTGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000853.2-861s21c1
Sequence:CCGGAGCAGGAATGGCTTGCCTAAGCTCGAGCTTAGGCAAGCCATTCCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000853
GSTT1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase theta 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000853.1-115s1c1
Sequence:CCGGCAGCACTTAAGCGATGCCTTTCTCGAGAAAGGCATCGCTTAAGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000853.1-102s1c1
Sequence:CCGGTCTGATTAAAGGTCAGCACTTCTCGAGAAGTGCTGACCTTTAATCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000853.1-225s1c1
Sequence:CCGGGCGCAAATATAAGGTCCCTGACTCGAGTCAGGGACCTTATATTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000853.1-57s1c1
Sequence:CCGGCTTTGCCAAGAAGAACGACATCTCGAGATGTCGTTCTTCTTGGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083798    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000853.1-818s1c1
Sequence:CCGGGCTTGCTTAAGACTTGCCCAACTCGAGTTGGGCAAGTCTTAAGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000853.2-389s21c1
Sequence:CCGGGGCCTTGTGGCATAAGGTGATCTCGAGATCACCTTATGCCACAAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000853.2-235s21c1
Sequence:CCGGACTTCACCTTGACGGAGAGTGCTCGAGCACTCTCCGTCAAGGTGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000853.2-861s21c1
Sequence:CCGGAGCAGGAATGGCTTGCCTAAGCTCGAGCTTAGGCAAGCCATTCCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)