EMAIL THIS PAGE TO A FRIEND

GSTT2

glutathione S-transferase theta 2

89 Gene Product Result for
Synonyms: GSTT2B
UniProtKB ID: P0CG29, O60665, P30712, Q6IPV7, Q9HD76
Gene ID:
Human(2953) Summary: Glutathione S-transferase (GSTs) theta 2 (GSTT2) is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: Alpha, Mu, Pi, Theta, and Zeta. The theta class members GSTT1 and GSTT2 share 55% amino acid sequence identity and both are thought to have an important role in human carcinogenesis. The theta genes have a similar structure, being composed of five exons with identical exon/intron boundaries. [provided by RefSeq, Jul 2008]
Mouse(14872) glutathione S-transferase, theta 2
Rat(29487) glutathione S-transferase, theta 2
fruit fly(246386) Glutathione S transferase T2
Thale Cress(834125) glutathione S-transferase THETA 2
domestic guinea pig(100717041) glutathione S-transferase theta 2
naked mole-rat(101714128) glutathione S-transferase theta 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS52 GST T2-2, Recombinant Human human pricing
GS39 GST T2-2, Recombinant Rat rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010361 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010361 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010361 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000854 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046841 MISSION® esiRNA esiRNA targeting mouse Gstt2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000854 Rosetta Predictions human pricing
NM_012796 Rosetta Predictions rat pricing
NM_010361 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099832 predicted 241
2 SASI_Hs02_00303366 predicted 664
3 SASI_Hs02_00303367 predicted 376
4 SASI_Hs01_00099833 predicted 701
5 SASI_Hs01_00099834 predicted 280
6 SASI_Hs01_00099835 predicted 239
7 SASI_Hs01_00099837 predicted 240
8 SASI_Hs01_00099838 predicted 251
9 SASI_Hs01_00099840 predicted 385
10 SASI_Hs02_00303368 predicted 195
11 SASI_Hs01_00099836 predicted 243
12 SASI_Hs01_00099839 predicted 547
13 SASI_Hs01_00099841 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108146 predicted 632
2 SASI_Rn01_00108147 predicted 388
3 SASI_Rn02_00260224 predicted 518
4 SASI_Rn01_00108148 predicted 304
5 SASI_Rn01_00108149 predicted 282
6 SASI_Rn01_00108151 predicted 437
7 SASI_Rn01_00108150 predicted 214
8 SASI_Rn01_00108152 predicted 375
9 SASI_Rn01_00108154 predicted 419
10 SASI_Rn01_00108155 predicted 550
11 SASI_Rn01_00108153 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010361 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084275 predicted 850
2 SASI_Mm01_00084276 predicted 993
3 SASI_Mm01_00084277 predicted 981
4 SASI_Mm02_00318402 predicted 721
5 SASI_Mm01_00084279 predicted 898
6 SASI_Mm02_00318403 predicted 770
7 SASI_Mm02_00318404 predicted 741
8 SASI_Mm01_00084280 predicted 838
9 SASI_Mm02_00318405 predicted 789
10 SASI_Mm01_00084282 predicted 1084
11 SASI_Mm01_00084278 predicted 303
12 SASI_Mm01_00084281 predicted 487
13 SASI_Mm01_00084283 predicted 415
14 SASI_Mm01_00084284 predicted 478
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010361
GSTT2 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase theta 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-135s1c1
Sequence:CCGGCCAGGTGAACTGCTTAAACAACTCGAGTTGTTTAAGCAGTTCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-136s1c1
Sequence:CCGGCAGGTGAACTGCTTAAACAAACTCGAGTTTGTTTAAGCAGTTCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-306s1c1
Sequence:CCGGCGACAACATCCGTGGTACTTTCTCGAGAAAGTACCACGGATGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-529s1c1
Sequence:CCGGGCTCTTGGCTATAACCTGTTTCTCGAGAAACAGGTTATAGCCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-91s1c1
Sequence:CCGGCGTACCGTGGATATACTCAAACTCGAGTTTGAGTATATCCACGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010361
GSTT2 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase theta 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-135s1c1
Sequence:CCGGCCAGGTGAACTGCTTAAACAACTCGAGTTGTTTAAGCAGTTCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-136s1c1
Sequence:CCGGCAGGTGAACTGCTTAAACAAACTCGAGTTTGTTTAAGCAGTTCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-306s1c1
Sequence:CCGGCGACAACATCCGTGGTACTTTCTCGAGAAAGTACCACGGATGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-529s1c1
Sequence:CCGGGCTCTTGGCTATAACCTGTTTCTCGAGAAACAGGTTATAGCCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-91s1c1
Sequence:CCGGCGTACCGTGGATATACTCAAACTCGAGTTTGAGTATATCCACGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010361
GSTT2 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase theta 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-135s1c1
Sequence:CCGGCCAGGTGAACTGCTTAAACAACTCGAGTTGTTTAAGCAGTTCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-136s1c1
Sequence:CCGGCAGGTGAACTGCTTAAACAAACTCGAGTTTGTTTAAGCAGTTCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-306s1c1
Sequence:CCGGCGACAACATCCGTGGTACTTTCTCGAGAAAGTACCACGGATGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-529s1c1
Sequence:CCGGGCTCTTGGCTATAACCTGTTTCTCGAGAAACAGGTTATAGCCAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010361.1-91s1c1
Sequence:CCGGCGTACCGTGGATATACTCAAACTCGAGTTTGAGTATATCCACGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000854
VALIDATED
GSTT2 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase theta 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-691s1c1
Sequence:CCGGCCACAGCATCATCTTGAGCATCTCGAGATGCTCAAGATGATGCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-823s1c1
Sequence:CCGGGATTAGCAACAAGGATTCATTCTCGAGAATGAATCCTTGTTGCTAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000854.2-829s1c1
Sequence:CCGGCAACAAGGATTCATTCTGTTACTCGAGTAACAGAATGAATCCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-274s1c1
Sequence:CCGGCCTGATTTACCTGAGCTGTAACTCGAGTTACAGCTCAGGTAAATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-115s1c1
Sequence:CCGGCTACATCTTCGCCAAGAAGAACTCGAGTTCTTCTTGGCGAAGATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-922s1c1
Sequence:CCGGGACAAGACACTCAGTGTCCTTCTCGAGAAGGACACTGAGTGTCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000854.2-181s1c1
Sequence:CCGGGCACAAGAGCAAGGAGTTCTTCTCGAGAAGAACTCCTTGCTCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-189s1c1
Sequence:CCGGGCAAGGAGTTCTTGCAGATCACTCGAGTGATCTGCAAGAACTCCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-112s1c1
Sequence:CCGGCGTCTACATCTTCGCCAAGAACTCGAGTTCTTGGCGAAGATGTAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000854.2-121s1c1
Sequence:CCGGCTTCGCCAAGAAGAATGGCATCTCGAGATGCCATTCTTCTTGGCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000854
VALIDATED
GSTT2 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase theta 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-691s1c1
Sequence:CCGGCCACAGCATCATCTTGAGCATCTCGAGATGCTCAAGATGATGCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-823s1c1
Sequence:CCGGGATTAGCAACAAGGATTCATTCTCGAGAATGAATCCTTGTTGCTAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000854.2-829s1c1
Sequence:CCGGCAACAAGGATTCATTCTGTTACTCGAGTAACAGAATGAATCCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-274s1c1
Sequence:CCGGCCTGATTTACCTGAGCTGTAACTCGAGTTACAGCTCAGGTAAATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-115s1c1
Sequence:CCGGCTACATCTTCGCCAAGAAGAACTCGAGTTCTTCTTGGCGAAGATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-922s1c1
Sequence:CCGGGACAAGACACTCAGTGTCCTTCTCGAGAAGGACACTGAGTGTCTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000854.2-181s1c1
Sequence:CCGGGCACAAGAGCAAGGAGTTCTTCTCGAGAAGAACTCCTTGCTCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-189s1c1
Sequence:CCGGGCAAGGAGTTCTTGCAGATCACTCGAGTGATCTGCAAGAACTCCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-112s1c1
Sequence:CCGGCGTCTACATCTTCGCCAAGAACTCGAGTTCTTGGCGAAGATGTAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000854.2-121s1c1
Sequence:CCGGCTTCGCCAAGAAGAATGGCATCTCGAGATGCCATTCTTCTTGGCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000854
VALIDATED
GSTT2 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase theta 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-691s1c1
Sequence:CCGGCCACAGCATCATCTTGAGCATCTCGAGATGCTCAAGATGATGCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-823s1c1
Sequence:CCGGGATTAGCAACAAGGATTCATTCTCGAGAATGAATCCTTGTTGCTAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000854.2-829s1c1
Sequence:CCGGCAACAAGGATTCATTCTGTTACTCGAGTAACAGAATGAATCCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-274s1c1
Sequence:CCGGCCTGATTTACCTGAGCTGTAACTCGAGTTACAGCTCAGGTAAATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-115s1c1
Sequence:CCGGCTACATCTTCGCCAAGAAGAACTCGAGTTCTTCTTGGCGAAGATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-922s1c1
Sequence:CCGGGACAAGACACTCAGTGTCCTTCTCGAGAAGGACACTGAGTGTCTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163032    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000854.2-181s1c1
Sequence:CCGGGCACAAGAGCAAGGAGTTCTTCTCGAGAAGAACTCCTTGCTCTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-189s1c1
Sequence:CCGGGCAAGGAGTTCTTGCAGATCACTCGAGTGATCTGCAAGAACTCCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_000854.2-112s1c1
Sequence:CCGGCGTCTACATCTTCGCCAAGAACTCGAGTTCTTGGCGAAGATGTAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000854.2-121s1c1
Sequence:CCGGCTTCGCCAAGAAGAATGGCATCTCGAGATGCCATTCTTCTTGGCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)