EMAIL THIS PAGE TO A FRIEND

GSTTP1

glutathione S-transferase theta pseudogene 1

12 Gene Product Result for
Synonyms: HS322B1A
Species: Human GSTTP1(25774)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015371 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015371 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015371 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_003081 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378067 predicted 223
2 SASI_Hs02_00378068 predicted 248
3 SASI_Hs02_00378069 predicted 373
4 SASI_Hs02_00378070 predicted 415
5 SASI_Hs02_00378071 predicted 378
6 SASI_Hs02_00378072 predicted 250
7 SASI_Hs02_00378073 predicted 278
8 SASI_Hs02_00378074 predicted 408
9 SASI_Hs02_00378075 predicted 381
10 SASI_Hs02_00378076 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015371
GSTTP1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase theta pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015371.1-62s1c1
Sequence:CCGGCTTCTCGAAGAAGCATGACATCTCGAGATGTCATGCTTCTTCGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015371.1-89s1c1
Sequence:CCGGCAACTTTCAGTTTGTGGATCTCTCGAGAGATCCACAAACTGAAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015371.1-172s1c1
Sequence:CCGGGCCTCAAAGATGGGAAATTTACTCGAGTAAATTTCCCATCTTTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015371.1-530s1c1
Sequence:CCGGGATTCAATGGTCAAGGAGAATCTCGAGATTCTCCTTGACCATTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015371.1-80s1c1
Sequence:CCGGCATCCAGTTCAACTTTCAGTTCTCGAGAACTGAAAGTTGAACTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015371
GSTTP1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase theta pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015371.1-62s1c1
Sequence:CCGGCTTCTCGAAGAAGCATGACATCTCGAGATGTCATGCTTCTTCGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015371.1-89s1c1
Sequence:CCGGCAACTTTCAGTTTGTGGATCTCTCGAGAGATCCACAAACTGAAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015371.1-172s1c1
Sequence:CCGGGCCTCAAAGATGGGAAATTTACTCGAGTAAATTTCCCATCTTTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015371.1-530s1c1
Sequence:CCGGGATTCAATGGTCAAGGAGAATCTCGAGATTCTCCTTGACCATTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015371.1-80s1c1
Sequence:CCGGCATCCAGTTCAACTTTCAGTTCTCGAGAACTGAAAGTTGAACTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015371
GSTTP1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase theta pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015371.1-62s1c1
Sequence:CCGGCTTCTCGAAGAAGCATGACATCTCGAGATGTCATGCTTCTTCGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015371.1-89s1c1
Sequence:CCGGCAACTTTCAGTTTGTGGATCTCTCGAGAGATCCACAAACTGAAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015371.1-172s1c1
Sequence:CCGGGCCTCAAAGATGGGAAATTTACTCGAGTAAATTTCCCATCTTTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015371.1-530s1c1
Sequence:CCGGGATTCAATGGTCAAGGAGAATCTCGAGATTCTCCTTGACCATTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015371.1-80s1c1
Sequence:CCGGCATCCAGTTCAACTTTCAGTTCTCGAGAACTGAAAGTTGAACTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)