EMAIL THIS PAGE TO A FRIEND

GSTZ1

glutathione S-transferase zeta 1

78 Gene Product Result for
Synonyms: GSTZ1-1 MAAI MAI
Gene ID:
Human(2954) Summary: This gene is a member of the glutathione S-transferase (GSTs) super-family which encodes multifunctional enzymes important in the detoxification of electrophilic molecules, including carcinogens, mutagens, and several therapeutic drugs, by conjugation with glutathione. This enzyme also plays a significant role in the catabolism of phenylalanine and tyrosine. Thus defects in this enzyme may lead to severe metabolic disorders including alkaptonuria, phenylketonuria and tyrosinaemia. Several transcript variants of this gene encode multiple protein isoforms. [provided by RefSeq, Jul 2008]
Mouse(14874) glutathione transferase zeta 1 (maleylacetoacetate isomerase)
Rat(681913) glutathione S-transferase zeta 1
Zebrafish(436754) glutathione S-transferase zeta 1
fruit fly(41132) Glutathione S transferase Z1
Thale Cress(814770) glutathione S-transferase zeta-class 1
chicken(423374) glutathione S-transferase zeta 1
dog(490806) glutathione S-transferase zeta 1
cow(514822) glutathione transferase zeta 1
domestic cat(101101390) glutathione S-transferase zeta 1
sheep(101113936) glutathione S-transferase zeta 1
domestic guinea pig(100726667) glutathione S-transferase zeta 1
naked mole-rat(101706169) glutathione S-transferase zeta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
GS77 GST Z1-1, Recombinant Human human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010363 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010363 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010363 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001513 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001513 Rosetta Predictions human pricing
NM_145870 Rosetta Predictions human pricing
NM_145871 Rosetta Predictions human pricing
NM_001109445 Rosetta Predictions rat pricing
NM_010363 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187606 predicted 920
2 SASI_Hs01_00187607 predicted 1132
3 SASI_Hs01_00187608 predicted 1116
4 SASI_Hs01_00187609 predicted 999
5 SASI_Hs01_00187610 predicted 1136
6 SASI_Hs02_00332022 predicted 921
7 SASI_Hs01_00187611 predicted 917
8 SASI_Hs01_00187612 predicted 1138
9 SASI_Hs01_00187613 predicted 1084
10 SASI_Hs01_00187615 predicted 1132
11 SASI_Hs01_00187614 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206634 predicted 706
2 SASI_Hs01_00206635 predicted 919
3 SASI_Hs01_00206636 predicted 900
4 SASI_Hs01_00206637 predicted 784
5 SASI_Hs01_00206638 predicted 919
6 SASI_Hs02_00365400 predicted 702
7 SASI_Hs01_00206639 predicted 705
8 SASI_Hs01_00206640 predicted 918
9 SASI_Hs01_00206641 predicted 865
10 SASI_Hs01_00206643 predicted 921
11 SASI_Hs01_00206642 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060114 predicted 573
2 SASI_Hs01_00060115 predicted 800
3 SASI_Hs01_00060116 predicted 777
4 SASI_Hs01_00060117 predicted 661
5 SASI_Hs01_00060118 predicted 793
6 SASI_Hs02_00365401 predicted 579
7 SASI_Hs01_00060119 predicted 580
8 SASI_Hs01_00060120 predicted 790
9 SASI_Hs01_00060121 predicted 747
10 SASI_Hs01_00060123 predicted 794
11 SASI_Hs01_00060122 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109445 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248477 predicted 251
2 SASI_Rn02_00248478 predicted 1180
3 SASI_Rn02_00248479 predicted 518
4 SASI_Rn02_00248480 predicted 1197
5 SASI_Rn02_00248481 predicted 566
6 SASI_Rn02_00248482 predicted 986
7 SASI_Rn02_00248483 predicted 744
8 SASI_Rn02_00248484 predicted 1105
9 SASI_Rn02_00248485 predicted 705
10 SASI_Rn02_00248486 predicted 767
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165503 predicted 561
2 SASI_Mm01_00165504 predicted 510
3 SASI_Mm01_00165505 predicted 563
4 SASI_Mm01_00165506 predicted 212
5 SASI_Mm01_00165507 predicted 747
6 SASI_Mm02_00318409 predicted 1048
7 SASI_Mm02_00318410 predicted 868
8 SASI_Mm01_00165508 predicted 750
9 SASI_Mm01_00165509 predicted 509
10 SASI_Mm01_00165510 predicted 864
11 SASI_Mm01_00165511 predicted 584
12 SASI_Mm01_00165512 predicted 774
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010363
VALIDATED
GSTZ1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase zeta 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010363.2-1132s1c1
Sequence:CCGGCCCAGAAATGAATGCATTATACTCGAGTATAATGCATTCATTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010363.2-632s1c1
Sequence:CCGGGAAAGGTTCAAGGTGGATCTACTCGAGTAGATCCACCTTGAACCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010363.2-661s1c1
Sequence:CCGGCCCTACCATCAGTCACATCAACTCGAGTTGATGTGACTGATGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010363.2-211s1c1
Sequence:CCGGAGTGCCCATCAACCTCATAAACTCGAGTTTATGAGGTTGATGGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010363.2-510s1c1
Sequence:CCGGAGGTTATTACTTCCGGCTTTACTCGAGTAAAGCCGGAAGTAATAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010363.3-510s21c1
Sequence:CCGGAGGTTATTACTTCCGGCTTTACTCGAGTAAAGCCGGAAGTAATAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010363.3-1132s21c1
Sequence:CCGGCCCAGAAATGAATGCATTATACTCGAGTATAATGCATTCATTTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010363.3-632s21c1
Sequence:CCGGGAAAGGTTCAAGGTGGATCTACTCGAGTAGATCCACCTTGAACCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010363.3-661s21c1
Sequence:CCGGCCCTACCATCAGTCACATCAACTCGAGTTGATGTGACTGATGGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010363.3-211s21c1
Sequence:CCGGAGTGCCCATCAACCTCATAAACTCGAGTTTATGAGGTTGATGGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010363
VALIDATED
GSTZ1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase zeta 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010363.2-1132s1c1
Sequence:CCGGCCCAGAAATGAATGCATTATACTCGAGTATAATGCATTCATTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010363.2-632s1c1
Sequence:CCGGGAAAGGTTCAAGGTGGATCTACTCGAGTAGATCCACCTTGAACCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010363.2-661s1c1
Sequence:CCGGCCCTACCATCAGTCACATCAACTCGAGTTGATGTGACTGATGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010363.2-211s1c1
Sequence:CCGGAGTGCCCATCAACCTCATAAACTCGAGTTTATGAGGTTGATGGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010363.2-510s1c1
Sequence:CCGGAGGTTATTACTTCCGGCTTTACTCGAGTAAAGCCGGAAGTAATAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010363.3-510s21c1
Sequence:CCGGAGGTTATTACTTCCGGCTTTACTCGAGTAAAGCCGGAAGTAATAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010363.3-1132s21c1
Sequence:CCGGCCCAGAAATGAATGCATTATACTCGAGTATAATGCATTCATTTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010363.3-632s21c1
Sequence:CCGGGAAAGGTTCAAGGTGGATCTACTCGAGTAGATCCACCTTGAACCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010363.3-661s21c1
Sequence:CCGGCCCTACCATCAGTCACATCAACTCGAGTTGATGTGACTGATGGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010363.3-211s21c1
Sequence:CCGGAGTGCCCATCAACCTCATAAACTCGAGTTTATGAGGTTGATGGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010363
VALIDATED
GSTZ1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase zeta 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103080    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010363.2-1132s1c1
Sequence:CCGGCCCAGAAATGAATGCATTATACTCGAGTATAATGCATTCATTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010363.2-632s1c1
Sequence:CCGGGAAAGGTTCAAGGTGGATCTACTCGAGTAGATCCACCTTGAACCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010363.2-661s1c1
Sequence:CCGGCCCTACCATCAGTCACATCAACTCGAGTTGATGTGACTGATGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010363.2-211s1c1
Sequence:CCGGAGTGCCCATCAACCTCATAAACTCGAGTTTATGAGGTTGATGGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010363.2-510s1c1
Sequence:CCGGAGGTTATTACTTCCGGCTTTACTCGAGTAAAGCCGGAAGTAATAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010363.3-510s21c1
Sequence:CCGGAGGTTATTACTTCCGGCTTTACTCGAGTAAAGCCGGAAGTAATAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010363.3-1132s21c1
Sequence:CCGGCCCAGAAATGAATGCATTATACTCGAGTATAATGCATTCATTTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010363.3-632s21c1
Sequence:CCGGGAAAGGTTCAAGGTGGATCTACTCGAGTAGATCCACCTTGAACCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010363.3-661s21c1
Sequence:CCGGCCCTACCATCAGTCACATCAACTCGAGTTGATGTGACTGATGGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010363.3-211s21c1
Sequence:CCGGAGTGCCCATCAACCTCATAAACTCGAGTTTATGAGGTTGATGGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001513
VALIDATED
GSTZ1 MISSION shRNA Bacterial Glycerol Stock
glutathione S-transferase zeta 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001513.2-889s1c1
Sequence:CCGGGCTGAAAGATTCAAGGTGGATCTCGAGATCCACCTTGAATCTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001513.2-711s1c1
Sequence:CCGGGCAGAACCTGTCTGTCCTGAACTCGAGTTCAGGACAGACAGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001513.2-817s1c1
Sequence:CCGGACAGCGGGCATATACTGTGTACTCGAGTACACAGTATATGCCCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001513.2-990s1c1
Sequence:CCGGGCAGCCAGATACACCCACTGACTCGAGTCAGTGGGTGTATCTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-889s21c1
Sequence:CCGGGCTGAAAGATTCAAGGTGGATCTCGAGATCCACCTTGAATCTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-711s21c1
Sequence:CCGGGCAGAACCTGTCTGTCCTGAACTCGAGTTCAGGACAGACAGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-990s21c1
Sequence:CCGGGCAGCCAGATACACCCACTGACTCGAGTCAGTGGGTGTATCTGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-666s21c1
Sequence:CCGGCGTGCGTATGATTTCTGACCTCTCGAGAGGTCAGAAATCATACGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-817s21c1
Sequence:CCGGACAGCGGGCATATACTGTGTACTCGAGTACACAGTATATGCCCGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001513
VALIDATED
GSTZ1 MISSION shRNA shRNA Plasmid DNA
glutathione S-transferase zeta 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001513.2-889s1c1
Sequence:CCGGGCTGAAAGATTCAAGGTGGATCTCGAGATCCACCTTGAATCTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001513.2-711s1c1
Sequence:CCGGGCAGAACCTGTCTGTCCTGAACTCGAGTTCAGGACAGACAGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001513.2-817s1c1
Sequence:CCGGACAGCGGGCATATACTGTGTACTCGAGTACACAGTATATGCCCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001513.2-990s1c1
Sequence:CCGGGCAGCCAGATACACCCACTGACTCGAGTCAGTGGGTGTATCTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-889s21c1
Sequence:CCGGGCTGAAAGATTCAAGGTGGATCTCGAGATCCACCTTGAATCTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-711s21c1
Sequence:CCGGGCAGAACCTGTCTGTCCTGAACTCGAGTTCAGGACAGACAGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-990s21c1
Sequence:CCGGGCAGCCAGATACACCCACTGACTCGAGTCAGTGGGTGTATCTGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-666s21c1
Sequence:CCGGCGTGCGTATGATTTCTGACCTCTCGAGAGGTCAGAAATCATACGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-817s21c1
Sequence:CCGGACAGCGGGCATATACTGTGTACTCGAGTACACAGTATATGCCCGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001513
VALIDATED
GSTZ1 MISSION shRNA Lentiviral Transduction Particles
glutathione S-transferase zeta 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001513.2-889s1c1
Sequence:CCGGGCTGAAAGATTCAAGGTGGATCTCGAGATCCACCTTGAATCTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001513.2-711s1c1
Sequence:CCGGGCAGAACCTGTCTGTCCTGAACTCGAGTTCAGGACAGACAGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001513.2-817s1c1
Sequence:CCGGACAGCGGGCATATACTGTGTACTCGAGTACACAGTATATGCCCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001513.2-990s1c1
Sequence:CCGGGCAGCCAGATACACCCACTGACTCGAGTCAGTGGGTGTATCTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-889s21c1
Sequence:CCGGGCTGAAAGATTCAAGGTGGATCTCGAGATCCACCTTGAATCTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-711s21c1
Sequence:CCGGGCAGAACCTGTCTGTCCTGAACTCGAGTTCAGGACAGACAGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-990s21c1
Sequence:CCGGGCAGCCAGATACACCCACTGACTCGAGTCAGTGGGTGTATCTGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-666s21c1
Sequence:CCGGCGTGCGTATGATTTCTGACCTCTCGAGAGGTCAGAAATCATACGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001513.3-817s21c1
Sequence:CCGGACAGCGGGCATATACTGTGTACTCGAGTACACAGTATATGCCCGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)