EMAIL THIS PAGE TO A FRIEND

GSX1

GS homeobox 1

55 Gene Product Result for
Synonyms: GSH1 Gsh-1
UniProtKB ID: Q9H4S2, Q9UD62
Gene ID:
Mouse(14842) GS homeobox 1
Rat(288457) GS homeobox 1
Zebrafish(449875) GS homeobox 1
cow(616983) GS homeobox 1
domestic cat(101098509) GS homeobox 1
dog(612833) GS homeobox 1
sheep(101113343) GS homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145657 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145657 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145657 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008178 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008178 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008178 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU020751 MISSION® esiRNA esiRNA targeting mouse Gsx1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145657 Rosetta Predictions human pricing
XM_001069419 Rosetta Predictions rat pricing
XM_221885 Rosetta Predictions rat pricing
NM_008178 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053690 predicted 529
2 SASI_Hs01_00053691 predicted 530
3 SASI_Hs01_00053692 predicted 539
4 SASI_Hs01_00053693 predicted 393
5 SASI_Hs01_00053694 predicted 289
6 SASI_Hs01_00053695 predicted 542
7 SASI_Hs01_00053696 predicted 52
8 SASI_Hs01_00053697 predicted 503
9 SASI_Hs01_00053698 predicted 584
10 SASI_Hs01_00053699 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327927 predicted 735
2 SASI_Rn02_00327928 predicted 256
3 SASI_Rn02_00327929 predicted 734
4 SASI_Rn02_00327930 predicted 799
5 SASI_Rn02_00327931 predicted 601
6 SASI_Rn02_00327932 predicted 780
7 SASI_Rn02_00327933 predicted 493
8 SASI_Rn02_00327934 predicted 782
9 SASI_Rn02_00327935 predicted 254
10 SASI_Rn02_00327936 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380398 predicted 740
2 SASI_Rn02_00380399 predicted 255
3 SASI_Rn02_00380400 predicted 730
4 SASI_Rn02_00380401 predicted 802
5 SASI_Rn02_00380402 predicted 592
6 SASI_Rn02_00380403 predicted 779
7 SASI_Rn02_00380404 predicted 485
8 SASI_Rn02_00380405 predicted 788
9 SASI_Rn02_00380406 predicted 252
10 SASI_Rn02_00380407 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313307 predicted 1297
2 SASI_Mm01_00186777 predicted 1436
3 SASI_Mm01_00186778 predicted 1423
4 SASI_Mm01_00186779 predicted 683
5 SASI_Mm01_00186780 predicted 1417
6 SASI_Mm02_00313308 predicted 1305
7 SASI_Mm01_00186782 predicted 1414
8 SASI_Mm01_00186784 predicted 539
9 SASI_Mm01_00186783 predicted 1276
10 SASI_Mm02_00313309 predicted 1289
11 SASI_Mm01_00186781 predicted 436
12 SASI_Mm01_00186785 predicted 555
13 SASI_Mm01_00186786 predicted 727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145657
GSX1 MISSION shRNA Bacterial Glycerol Stock
GS homeobox 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-537s1c1
Sequence:CCGGGCGCGAGTTCGCTTCTAATATCTCGAGATATTAGAAGCGAACTCGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-594s1c1
Sequence:CCGGCTACCTGAATCTGTCCGAGAACTCGAGTTCTCGGACAGATTCAGGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-543s1c1
Sequence:CCGGGTTCGCTTCTAATATGTACCTCTCGAGAGGTACATATTAGAAGCGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-399s1c1
Sequence:CCGGCGCGCTCTACCAGACCTCCTACTCGAGTAGGAGGTCTGGTAGAGCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-477s1c1
Sequence:CCGGGCTGCCCAGCAGCAAGAGGATCTCGAGATCCTCTTGCTGCTGGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145657.1-458s21c1
Sequence:CCGGTGGACAGCAGCTCTAACCAGCCTCGAGGCTGGTTAGAGCTGCTGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145657.1-583s21c1
Sequence:CCGGGAGATCGCGACCTACCTGAATCTCGAGATTCAGGTAGGTCGCGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145657
GSX1 MISSION shRNA shRNA Plasmid DNA
GS homeobox 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-537s1c1
Sequence:CCGGGCGCGAGTTCGCTTCTAATATCTCGAGATATTAGAAGCGAACTCGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-594s1c1
Sequence:CCGGCTACCTGAATCTGTCCGAGAACTCGAGTTCTCGGACAGATTCAGGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-543s1c1
Sequence:CCGGGTTCGCTTCTAATATGTACCTCTCGAGAGGTACATATTAGAAGCGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-399s1c1
Sequence:CCGGCGCGCTCTACCAGACCTCCTACTCGAGTAGGAGGTCTGGTAGAGCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-477s1c1
Sequence:CCGGGCTGCCCAGCAGCAAGAGGATCTCGAGATCCTCTTGCTGCTGGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145657.1-458s21c1
Sequence:CCGGTGGACAGCAGCTCTAACCAGCCTCGAGGCTGGTTAGAGCTGCTGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145657.1-583s21c1
Sequence:CCGGGAGATCGCGACCTACCTGAATCTCGAGATTCAGGTAGGTCGCGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145657
GSX1 MISSION shRNA Lentiviral Transduction Particles
GS homeobox 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-537s1c1
Sequence:CCGGGCGCGAGTTCGCTTCTAATATCTCGAGATATTAGAAGCGAACTCGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-594s1c1
Sequence:CCGGCTACCTGAATCTGTCCGAGAACTCGAGTTCTCGGACAGATTCAGGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-543s1c1
Sequence:CCGGGTTCGCTTCTAATATGTACCTCTCGAGAGGTACATATTAGAAGCGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-399s1c1
Sequence:CCGGCGCGCTCTACCAGACCTCCTACTCGAGTAGGAGGTCTGGTAGAGCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145657.1-477s1c1
Sequence:CCGGGCTGCCCAGCAGCAAGAGGATCTCGAGATCCTCTTGCTGCTGGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145657.1-458s21c1
Sequence:CCGGTGGACAGCAGCTCTAACCAGCCTCGAGGCTGGTTAGAGCTGCTGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145657.1-583s21c1
Sequence:CCGGGAGATCGCGACCTACCTGAATCTCGAGATTCAGGTAGGTCGCGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008178
GSX1 MISSION shRNA Bacterial Glycerol Stock
GS homeobox 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000070666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008178.1-959s1c1
Sequence:CCGGAGATCTCACAGTCACTCCGTACTCGAGTACGGAGTGACTGTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008178.1-737s1c1
Sequence:CCGGCTATCTGAACCTGTCCGAGAACTCGAGTTCTCGGACAGGTTCAGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008178.1-227s1c1
Sequence:CCGGGCTGCGGGAAGCCAGCGACAACTCGAGTTGTCGCTGGCTTCCCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008178.1-422s1c1
Sequence:CCGGGCCGCTACTCAAGGCGTCCTTCTCGAGAAGGACGCCTTGAGTAGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008178
GSX1 MISSION shRNA shRNA Plasmid DNA
GS homeobox 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000070666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008178.1-959s1c1
Sequence:CCGGAGATCTCACAGTCACTCCGTACTCGAGTACGGAGTGACTGTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008178.1-737s1c1
Sequence:CCGGCTATCTGAACCTGTCCGAGAACTCGAGTTCTCGGACAGGTTCAGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008178.1-227s1c1
Sequence:CCGGGCTGCGGGAAGCCAGCGACAACTCGAGTTGTCGCTGGCTTCCCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008178.1-422s1c1
Sequence:CCGGGCCGCTACTCAAGGCGTCCTTCTCGAGAAGGACGCCTTGAGTAGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008178
GSX1 MISSION shRNA Lentiviral Transduction Particles
GS homeobox 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000070666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008178.1-959s1c1
Sequence:CCGGAGATCTCACAGTCACTCCGTACTCGAGTACGGAGTGACTGTGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008178.1-737s1c1
Sequence:CCGGCTATCTGAACCTGTCCGAGAACTCGAGTTCTCGGACAGGTTCAGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008178.1-227s1c1
Sequence:CCGGGCTGCGGGAAGCCAGCGACAACTCGAGTTGTCGCTGGCTTCCCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008178.1-422s1c1
Sequence:CCGGGCCGCTACTCAAGGCGTCCTTCTCGAGAAGGACGCCTTGAGTAGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)