EMAIL THIS PAGE TO A FRIEND

GSX2

GS homeobox 2

52 Gene Product Result for
Synonyms: GSH2
UniProtKB ID: Q9BZM3
Gene ID:
Mouse(14843) GS homeobox 2
Rat(364140) GS homeobox 2
Zebrafish(561076) GS homeobox 2
dog(482152) GS homeobox 2
chicken(429994) GS homeobox 2
cow(539228) GS homeobox 2
domestic cat(101091530) GS homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32208 Anti-GSH2 antibody produced in rabbit affinity isolated antibody dog, pig, human, rabbit, horse, bovine
immunohistochemistry, western blot pricing
SAB1304117 ANTI-GSX2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133267 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133267 Rosetta Predictions human pricing
XM_001076578 Rosetta Predictions rat pricing
XM_344233 Rosetta Predictions rat pricing
NM_133256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162000 predicted 316
2 SASI_Hs01_00162001 predicted 1028
3 SASI_Hs01_00162002 predicted 319
4 SASI_Hs01_00162003 predicted 1020
5 SASI_Hs01_00162005 predicted 992
6 SASI_Hs01_00162006 predicted 1005
7 SASI_Hs01_00162007 predicted 1023
8 SASI_Hs01_00161999 predicted 999
9 SASI_Hs01_00162008 predicted 322
10 SASI_Hs01_00162004 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353791 predicted 1317
2 SASI_Rn02_00353792 predicted 975
3 SASI_Rn02_00353793 predicted 1423
4 SASI_Rn02_00353794 predicted 1237
5 SASI_Rn02_00353795 predicted 440
6 SASI_Rn02_00353796 predicted 260
7 SASI_Rn02_00353797 predicted 1305
8 SASI_Rn02_00353798 predicted 1331
9 SASI_Rn02_00353799 predicted 1271
10 SASI_Rn02_00353800 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396971 predicted 1320
2 SASI_Rn02_00396972 predicted 974
3 SASI_Rn02_00396973 predicted 1351
4 SASI_Rn02_00396974 predicted 1418
5 SASI_Rn02_00396975 predicted 1235
6 SASI_Rn02_00396976 predicted 1302
7 SASI_Rn02_00396977 predicted 1334
8 SASI_Rn02_00396978 predicted 1271
9 SASI_Rn02_00396979 predicted 1087
10 SASI_Rn02_00396980 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034099 predicted 226
2 SASI_Mm01_00034100 predicted 856
3 SASI_Mm01_00034101 predicted 945
4 SASI_Mm01_00034102 predicted 210
5 SASI_Mm01_00034103 predicted 245
6 SASI_Mm01_00034104 predicted 851
7 SASI_Mm01_00034106 predicted 945
8 SASI_Mm01_00034107 predicted 980
9 SASI_Mm01_00034108 predicted 996
10 SASI_Mm02_00338516 predicted 958
11 SASI_Mm01_00034105 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133267
GSX2 MISSION shRNA Bacterial Glycerol Stock
GS homeobox 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133267.2-290s21c1
Sequence:CCGGCGCTCATCATCAAGGACACCTCTCGAGAGGTGTCCTTGATGATGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133267.2-888s21c1
Sequence:CCGGGTTCACTAGCACGCAACTCCTCTCGAGAGGAGTTGCGTGCTAGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-1005s1c1
Sequence:CCGGCGGAGGATTGAAATCGCCACTCTCGAGAGTGGCGATTTCAATCCTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133267.2-381s21c1
Sequence:CCGGCCCATTGGTGATGTCCGTGTCCTCGAGGACACGGACATCACCAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-399s1c1
Sequence:CCGGCCGGATTTCTTCATCCCGCTTCTCGAGAAGCGGGATGAAGAAATCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-968s1c1
Sequence:CCGGGAGAGAATTCTCTTCCAACATCTCGAGATGTTGGAAGAGAATTCTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-866s1c1
Sequence:CCGGGAGATTCCACTGCCTCACCATCTCGAGATGGTGAGGCAGTGGAATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-675s1c1
Sequence:CCGGCGGGTGAACCATGCGCATCATCTCGAGATGATGCGCATGGTTCACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133267.2-573s21c1
Sequence:CCGGTCTGCTTAAGAGCCAGTTCTCCTCGAGGAGAACTGGCTCTTAAGCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133267
GSX2 MISSION shRNA shRNA Plasmid DNA
GS homeobox 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133267.2-290s21c1
Sequence:CCGGCGCTCATCATCAAGGACACCTCTCGAGAGGTGTCCTTGATGATGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133267.2-888s21c1
Sequence:CCGGGTTCACTAGCACGCAACTCCTCTCGAGAGGAGTTGCGTGCTAGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-1005s1c1
Sequence:CCGGCGGAGGATTGAAATCGCCACTCTCGAGAGTGGCGATTTCAATCCTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133267.2-381s21c1
Sequence:CCGGCCCATTGGTGATGTCCGTGTCCTCGAGGACACGGACATCACCAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-399s1c1
Sequence:CCGGCCGGATTTCTTCATCCCGCTTCTCGAGAAGCGGGATGAAGAAATCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-968s1c1
Sequence:CCGGGAGAGAATTCTCTTCCAACATCTCGAGATGTTGGAAGAGAATTCTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-866s1c1
Sequence:CCGGGAGATTCCACTGCCTCACCATCTCGAGATGGTGAGGCAGTGGAATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-675s1c1
Sequence:CCGGCGGGTGAACCATGCGCATCATCTCGAGATGATGCGCATGGTTCACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133267.2-573s21c1
Sequence:CCGGTCTGCTTAAGAGCCAGTTCTCCTCGAGGAGAACTGGCTCTTAAGCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133267
GSX2 MISSION shRNA Lentiviral Transduction Particles
GS homeobox 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133267.2-290s21c1
Sequence:CCGGCGCTCATCATCAAGGACACCTCTCGAGAGGTGTCCTTGATGATGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133267.2-888s21c1
Sequence:CCGGGTTCACTAGCACGCAACTCCTCTCGAGAGGAGTTGCGTGCTAGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-1005s1c1
Sequence:CCGGCGGAGGATTGAAATCGCCACTCTCGAGAGTGGCGATTTCAATCCTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133267.2-381s21c1
Sequence:CCGGCCCATTGGTGATGTCCGTGTCCTCGAGGACACGGACATCACCAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-399s1c1
Sequence:CCGGCCGGATTTCTTCATCCCGCTTCTCGAGAAGCGGGATGAAGAAATCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-968s1c1
Sequence:CCGGGAGAGAATTCTCTTCCAACATCTCGAGATGTTGGAAGAGAATTCTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-866s1c1
Sequence:CCGGGAGATTCCACTGCCTCACCATCTCGAGATGGTGAGGCAGTGGAATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133267.1-675s1c1
Sequence:CCGGCGGGTGAACCATGCGCATCATCTCGAGATGATGCGCATGGTTCACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133267.2-573s21c1
Sequence:CCGGTCTGCTTAAGAGCCAGTTCTCCTCGAGGAGAACTGGCTCTTAAGCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133256
GSX2 MISSION shRNA Bacterial Glycerol Stock
GS homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133256.2-1482s21c1
Sequence:CCGGATCATTGAAGTTGCCATTAATCTCGAGATTAATGGCAACTTCAATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-244s1c1
Sequence:CCGGGCCGGATTTCTTCATCCCGCTCTCGAGAGCGGGATGAAGAAATCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-869s1c1
Sequence:CCGGGCGACATACCTAAACCTGTCACTCGAGTGACAGGTTTAGGTATGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-1046s1c1
Sequence:CCGGGCTAACGAAGACAAGGAGATTCTCGAGAATCTCCTTGTCTTCGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133256.2-773s21c1
Sequence:CCGGAGGATGAGGACAGCGTTTACCCTCGAGGGTAAACGCTGTCCTCATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-957s1c1
Sequence:CCGGCGAGGAACAATCACACAAGCTCTCGAGAGCTTGTGTGATTGTTCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-817s1c1
Sequence:CCGGGCGAGAATTCTCTTCCAATATCTCGAGATATTGGAAGAGAATTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133256.2-1226s21c1
Sequence:CCGGTTGAAGCTAGCTCCTCTTTATCTCGAGATAAAGAGGAGCTAGCTTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133256
GSX2 MISSION shRNA shRNA Plasmid DNA
GS homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133256.2-1482s21c1
Sequence:CCGGATCATTGAAGTTGCCATTAATCTCGAGATTAATGGCAACTTCAATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-244s1c1
Sequence:CCGGGCCGGATTTCTTCATCCCGCTCTCGAGAGCGGGATGAAGAAATCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-869s1c1
Sequence:CCGGGCGACATACCTAAACCTGTCACTCGAGTGACAGGTTTAGGTATGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-1046s1c1
Sequence:CCGGGCTAACGAAGACAAGGAGATTCTCGAGAATCTCCTTGTCTTCGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133256.2-773s21c1
Sequence:CCGGAGGATGAGGACAGCGTTTACCCTCGAGGGTAAACGCTGTCCTCATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-957s1c1
Sequence:CCGGCGAGGAACAATCACACAAGCTCTCGAGAGCTTGTGTGATTGTTCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-817s1c1
Sequence:CCGGGCGAGAATTCTCTTCCAATATCTCGAGATATTGGAAGAGAATTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133256.2-1226s21c1
Sequence:CCGGTTGAAGCTAGCTCCTCTTTATCTCGAGATAAAGAGGAGCTAGCTTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133256
GSX2 MISSION shRNA Lentiviral Transduction Particles
GS homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133256.2-1482s21c1
Sequence:CCGGATCATTGAAGTTGCCATTAATCTCGAGATTAATGGCAACTTCAATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-244s1c1
Sequence:CCGGGCCGGATTTCTTCATCCCGCTCTCGAGAGCGGGATGAAGAAATCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-869s1c1
Sequence:CCGGGCGACATACCTAAACCTGTCACTCGAGTGACAGGTTTAGGTATGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-1046s1c1
Sequence:CCGGGCTAACGAAGACAAGGAGATTCTCGAGAATCTCCTTGTCTTCGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133256.2-773s21c1
Sequence:CCGGAGGATGAGGACAGCGTTTACCCTCGAGGGTAAACGCTGTCCTCATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-957s1c1
Sequence:CCGGCGAGGAACAATCACACAAGCTCTCGAGAGCTTGTGTGATTGTTCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133256.1-817s1c1
Sequence:CCGGGCGAGAATTCTCTTCCAATATCTCGAGATATTGGAAGAGAATTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133256.2-1226s21c1
Sequence:CCGGTTGAAGCTAGCTCCTCTTTATCTCGAGATAAAGAGGAGCTAGCTTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)