EMAIL THIS PAGE TO A FRIEND

GTDC1

glycosyltransferase-like domain containing 1

195 Gene Product Result for
Synonyms: Hmat-Xa mat-Xa
Gene ID:
Mouse(227835) glycosyltransferase-like domain containing 1
Rat(362129) glycosyltransferase-like domain containing 1
Zebrafish(550132) glycosyltransferase-like domain containing 1
cow(534677) glycosyltransferase-like domain containing 1
Horse(100051265) glycosyltransferase-like domain containing 1
domestic cat(101096585) glycosyltransferase-like domain containing 1
dog(483908) glycosyltransferase-like domain containing 1
chicken(424304) glycosyltransferase-like domain containing 1
sheep(101122761) glycosyltransferase-like domain containing 1
Domestic Rabbit(100354103) glycosyltransferase-like domain containing 1
domestic guinea pig(100728290) glycosyltransferase-like domain containing 1
naked mole-rat(101708696) glycosyltransferase-like domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014118 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU082321 MISSION® esiRNA esiRNA targeting mouse Gtdc1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006636 Rosetta Predictions human pricing
NM_024659 Rosetta Predictions human pricing
NM_001024274 Rosetta Predictions rat pricing
NM_172662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138064 predicted 590
2 SASI_Hs01_00138065 predicted 555
3 SASI_Hs02_00305103 predicted 585
4 SASI_Hs01_00138066 predicted 553
5 SASI_Hs01_00138068 predicted 735
6 SASI_Hs01_00138069 predicted 790
7 SASI_Hs01_00138070 predicted 902
8 SASI_Hs01_00138071 predicted 756
9 SASI_Hs01_00138072 predicted 466
10 SASI_Hs01_00138073 predicted 600
11 SASI_Hs01_00138067 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033772 predicted 595
2 SASI_Hs01_00033773 predicted 567
3 SASI_Hs02_00357061 predicted 590
4 SASI_Hs01_00033774 predicted 557
5 SASI_Hs01_00033776 predicted 739
6 SASI_Hs01_00033777 predicted 806
7 SASI_Hs01_00033778 predicted 907
8 SASI_Hs01_00033779 predicted 760
9 SASI_Hs01_00033780 predicted 475
10 SASI_Hs01_00033781 predicted 604
11 SASI_Hs01_00033775 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092247 predicted 315
2 SASI_Rn01_00092248 predicted 822
3 SASI_Rn01_00092249 predicted 929
4 SASI_Rn01_00092250 predicted 407
5 SASI_Rn02_00202451 predicted 929
6 SASI_Rn01_00092251 predicted 866
7 SASI_Rn01_00092252 predicted 646
8 SASI_Rn01_00092253 predicted 414
9 SASI_Rn01_00092254 predicted 996
10 SASI_Rn01_00092255 predicted 770
11 SASI_Rn01_00092256 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056535 predicted 1229
2 SASI_Mm01_00056536 predicted 266
3 SASI_Mm01_00056537 predicted 577
4 SASI_Mm01_00056538 predicted 462
5 SASI_Mm01_00056539 predicted 437
6 SASI_Mm01_00056540 predicted 815
7 SASI_Mm01_00056541 predicted 1255
8 SASI_Mm01_00056542 predicted 635
9 SASI_Mm01_00056543 predicted 704
10 SASI_Mm01_00056544 predicted 942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172662
GTDC1 MISSION shRNA Bacterial Glycerol Stock
glycosyltransferase-like domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172662.2-893s21c1
Sequence:CCGGGACAACCCATCAGTCCATAAACTCGAGTTTATGGACTGATGGGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172662.2-1736s21c1
Sequence:CCGGACAGATTCCTAGAGACGTTATCTCGAGATAACGTCTCTAGGAATCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172662.2-310s21c1
Sequence:CCGGAGCACGCACAGCAGCCTTATACTCGAGTATAAGGCTGCTGTGCGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172662.2-658s21c1
Sequence:CCGGACCCAAGTGTCAAGTTATTTACTCGAGTAAATAACTTGACACTTGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172662.1-1350s1c1
Sequence:CCGGGCTGAGTATCTGTATTCCACACTCGAGTGTGGAATACAGATACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172662.1-633s1c1
Sequence:CCGGCCTAAGGATCTGGAAAGCATTCTCGAGAATGCTTTCCAGATCCTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172662.1-1041s1c1
Sequence:CCGGCCAGAGACGTTCTTAAAGATACTCGAGTATCTTTAAGAACGTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172662.1-829s1c1
Sequence:CCGGCACCGGAGAACTGTGAATCAACTCGAGTTGATTCACAGTTCTCCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172662
GTDC1 MISSION shRNA shRNA Plasmid DNA
glycosyltransferase-like domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172662.2-893s21c1
Sequence:CCGGGACAACCCATCAGTCCATAAACTCGAGTTTATGGACTGATGGGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172662.2-1736s21c1
Sequence:CCGGACAGATTCCTAGAGACGTTATCTCGAGATAACGTCTCTAGGAATCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172662.2-310s21c1
Sequence:CCGGAGCACGCACAGCAGCCTTATACTCGAGTATAAGGCTGCTGTGCGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172662.2-658s21c1
Sequence:CCGGACCCAAGTGTCAAGTTATTTACTCGAGTAAATAACTTGACACTTGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172662.1-1350s1c1
Sequence:CCGGGCTGAGTATCTGTATTCCACACTCGAGTGTGGAATACAGATACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172662.1-633s1c1
Sequence:CCGGCCTAAGGATCTGGAAAGCATTCTCGAGAATGCTTTCCAGATCCTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172662.1-1041s1c1
Sequence:CCGGCCAGAGACGTTCTTAAAGATACTCGAGTATCTTTAAGAACGTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172662.1-829s1c1
Sequence:CCGGCACCGGAGAACTGTGAATCAACTCGAGTTGATTCACAGTTCTCCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172662
GTDC1 MISSION shRNA Lentiviral Transduction Particles
glycosyltransferase-like domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172662.2-893s21c1
Sequence:CCGGGACAACCCATCAGTCCATAAACTCGAGTTTATGGACTGATGGGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172662.2-1736s21c1
Sequence:CCGGACAGATTCCTAGAGACGTTATCTCGAGATAACGTCTCTAGGAATCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172662.2-310s21c1
Sequence:CCGGAGCACGCACAGCAGCCTTATACTCGAGTATAAGGCTGCTGTGCGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172662.2-658s21c1
Sequence:CCGGACCCAAGTGTCAAGTTATTTACTCGAGTAAATAACTTGACACTTGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172662.1-1350s1c1
Sequence:CCGGGCTGAGTATCTGTATTCCACACTCGAGTGTGGAATACAGATACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172662.1-633s1c1
Sequence:CCGGCCTAAGGATCTGGAAAGCATTCTCGAGAATGCTTTCCAGATCCTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172662.1-1041s1c1
Sequence:CCGGCCAGAGACGTTCTTAAAGATACTCGAGTATCTTTAAGAACGTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172662.1-829s1c1
Sequence:CCGGCACCGGAGAACTGTGAATCAACTCGAGTTGATTCACAGTTCTCCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014118
GTDC1 MISSION shRNA Bacterial Glycerol Stock
glycosyltransferase-like domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-1997s1c1
Sequence:CCGGCCTGCTGCTTAAAGTCAGATTCTCGAGAATCTGACTTTAAGCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-1985s1c1
Sequence:CCGGCCAGATTATTTCCCTGCTGCTCTCGAGAGCAGCAGGGAAATAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-2001s1c1
Sequence:CCGGCTGCTTAAAGTCAGATTTCTTCTCGAGAAGAAATCTGACTTTAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-1926s1c1
Sequence:CCGGTGGGTCAGTAAGATGATTGATCTCGAGATCAATCATCTTACTGACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-1879s1c1
Sequence:CCGGTGTGGCAATATGCGGGCATTTCTCGAGAAATGCCCGCATATTGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014118
GTDC1 MISSION shRNA shRNA Plasmid DNA
glycosyltransferase-like domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-1997s1c1
Sequence:CCGGCCTGCTGCTTAAAGTCAGATTCTCGAGAATCTGACTTTAAGCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-1985s1c1
Sequence:CCGGCCAGATTATTTCCCTGCTGCTCTCGAGAGCAGCAGGGAAATAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-2001s1c1
Sequence:CCGGCTGCTTAAAGTCAGATTTCTTCTCGAGAAGAAATCTGACTTTAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-1926s1c1
Sequence:CCGGTGGGTCAGTAAGATGATTGATCTCGAGATCAATCATCTTACTGACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000036250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-1879s1c1
Sequence:CCGGTGTGGCAATATGCGGGCATTTCTCGAGAAATGCCCGCATATTGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014118
GTDC1 MISSION shRNA Lentiviral Transduction Particles
glycosyltransferase-like domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-1997s1c1
Sequence:CCGGCCTGCTGCTTAAAGTCAGATTCTCGAGAATCTGACTTTAAGCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-1985s1c1
Sequence:CCGGCCAGATTATTTCCCTGCTGCTCTCGAGAGCAGCAGGGAAATAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-2001s1c1
Sequence:CCGGCTGCTTAAAGTCAGATTTCTTCTCGAGAAGAAATCTGACTTTAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-1926s1c1
Sequence:CCGGTGGGTCAGTAAGATGATTGATCTCGAGATCAATCATCTTACTGACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000036250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014118.1-1879s1c1
Sequence:CCGGTGTGGCAATATGCGGGCATTTCTCGAGAAATGCCCGCATATTGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)