EMAIL THIS PAGE TO A FRIEND

GTF2A1L

general transcription factor IIA, 1-like

82 Gene Product Result for
Synonyms: ALF
UniProtKB ID: Q9UNN4, B4DY14, Q53FD9, Q5D050
Gene ID:
Human(11036) Summary: The assembly and stability of the RNA polymerase II transcription pre-initiation complex on a eukaryotic core promoter involve the effects of TFIIA on the interaction between TATA-binding protein (TBP) and DNA. This gene encodes a germ cell-specific counterpart of the large (alpha/beta) subunit of general transcription factor TFIIA that is able to stabilize the binding of TBP to DNA and may be uniquely important to testis biology. Alternative splicing for this locus has been observed and two variants, encoding distinct isoforms, have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Jul 2008]
Mouse(71828) general transcription factor IIA, 1-like
Rat(316711) general transcription factor IIA, 1-like
Domestic Rabbit(100534011) general transcription factor IIA, 1-like
domestic guinea pig(100726029) general transcription factor IIA, 1-like
naked mole-rat(101710993) general transcription factor IIA, 1-like
chicken(100534591) general transcription factor IIA, 1-like
Horse(100534009) general transcription factor IIA, 1-like
cow(505979) general transcription factor IIA, 1-like
dog(100534007) general transcription factor IIA, 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006872 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU030081 MISSION® esiRNA esiRNA targeting mouse Gtf2a1l (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006872 Rosetta Predictions human pricing
NM_172196 Rosetta Predictions human pricing
NM_001012136 Rosetta Predictions rat pricing
NM_023630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178695 predicted 1028
2 SASI_Hs01_00178696 predicted 283
3 SASI_Hs01_00178698 predicted 597
4 SASI_Hs01_00178699 predicted 516
5 SASI_Hs02_00342512 predicted 936
6 SASI_Hs01_00178700 predicted 447
7 SASI_Hs01_00178701 predicted 289
8 SASI_Hs01_00178702 predicted 819
9 SASI_Hs01_00178703 predicted 330
10 SASI_Hs01_00178704 predicted 779
11 SASI_Hs01_00178697 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140227 predicted 1025
2 SASI_Hs01_00140228 predicted 281
3 SASI_Hs01_00140230 predicted 600
4 SASI_Hs01_00140231 predicted 520
5 SASI_Hs02_00367898 predicted 938
6 SASI_Hs01_00140232 predicted 446
7 SASI_Hs01_00140233 predicted 284
8 SASI_Hs01_00140234 predicted 822
9 SASI_Hs01_00140235 predicted 327
10 SASI_Hs01_00140236 predicted 782
11 SASI_Hs01_00140229 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104416 predicted 1318
2 SASI_Rn01_00104417 predicted 1325
3 SASI_Rn01_00104418 predicted 1037
4 SASI_Rn01_00104419 predicted 1191
5 SASI_Rn01_00104420 predicted 883
6 SASI_Rn01_00104421 predicted 1161
7 SASI_Rn01_00104422 predicted 792
8 SASI_Rn01_00104423 predicted 1132
9 SASI_Rn01_00104424 predicted 1266
10 SASI_Rn01_00104425 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193840 predicted 327
2 SASI_Mm01_00193841 predicted 1041
3 SASI_Mm01_00193842 predicted 1271
4 SASI_Mm01_00193843 predicted 1335
5 SASI_Mm01_00193844 predicted 1177
6 SASI_Mm01_00193845 predicted 455
7 SASI_Mm02_00327242 predicted 800
8 SASI_Mm01_00193846 predicted 1156
9 SASI_Mm01_00193848 predicted 527
10 SASI_Mm01_00193849 predicted 529
11 SASI_Mm01_00193847 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006872
GTF2A1L MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIA, 1-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006872.2-1374s21c1
Sequence:CCGGTATTGTCTGTCAGTATGATAACTCGAGTTATCATACTGACAGACAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006872.2-123s21c1
Sequence:CCGGTGAAGGAGTTCGGAATCTATTCTCGAGAATAGATTCCGAACTCCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006872.2-643s21c1
Sequence:CCGGGTGCTACAGCAACCCGCAATTCTCGAGAATTGCGGGTTGCTGTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006872.2-1110s21c1
Sequence:CCGGAGTAGATGGAAGCGGTGATACCTCGAGGTATCACCGCTTCCATCTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-675s1c1
Sequence:CCGGGCCAGTAGATAGGAAACACTTCTCGAGAAGTGTTTCCTATCTACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-151s1c1
Sequence:CCGGGAAGGTATAGAGGAACAAGTTCTCGAGAACTTGTTCCTCTATACCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-1349s1c1
Sequence:CCGGCAGACCTGTTTGACACGGATACTCGAGTATCCGTGTCAAACAGGTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-522s1c1
Sequence:CCGGGCATCCAATTCAGCAAGTATTCTCGAGAATACTTGCTGAATTGGATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-300s1c1
Sequence:CCGGGCAATCGTCAACAGCATCATTCTCGAGAATGATGCTGTTGACGATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006872
GTF2A1L MISSION shRNA shRNA Plasmid DNA
general transcription factor IIA, 1-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006872.2-1374s21c1
Sequence:CCGGTATTGTCTGTCAGTATGATAACTCGAGTTATCATACTGACAGACAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006872.2-123s21c1
Sequence:CCGGTGAAGGAGTTCGGAATCTATTCTCGAGAATAGATTCCGAACTCCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006872.2-643s21c1
Sequence:CCGGGTGCTACAGCAACCCGCAATTCTCGAGAATTGCGGGTTGCTGTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006872.2-1110s21c1
Sequence:CCGGAGTAGATGGAAGCGGTGATACCTCGAGGTATCACCGCTTCCATCTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-675s1c1
Sequence:CCGGGCCAGTAGATAGGAAACACTTCTCGAGAAGTGTTTCCTATCTACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-151s1c1
Sequence:CCGGGAAGGTATAGAGGAACAAGTTCTCGAGAACTTGTTCCTCTATACCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-1349s1c1
Sequence:CCGGCAGACCTGTTTGACACGGATACTCGAGTATCCGTGTCAAACAGGTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-522s1c1
Sequence:CCGGGCATCCAATTCAGCAAGTATTCTCGAGAATACTTGCTGAATTGGATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-300s1c1
Sequence:CCGGGCAATCGTCAACAGCATCATTCTCGAGAATGATGCTGTTGACGATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006872
GTF2A1L MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIA, 1-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006872.2-1374s21c1
Sequence:CCGGTATTGTCTGTCAGTATGATAACTCGAGTTATCATACTGACAGACAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006872.2-123s21c1
Sequence:CCGGTGAAGGAGTTCGGAATCTATTCTCGAGAATAGATTCCGAACTCCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006872.2-643s21c1
Sequence:CCGGGTGCTACAGCAACCCGCAATTCTCGAGAATTGCGGGTTGCTGTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006872.2-1110s21c1
Sequence:CCGGAGTAGATGGAAGCGGTGATACCTCGAGGTATCACCGCTTCCATCTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-675s1c1
Sequence:CCGGGCCAGTAGATAGGAAACACTTCTCGAGAAGTGTTTCCTATCTACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-151s1c1
Sequence:CCGGGAAGGTATAGAGGAACAAGTTCTCGAGAACTTGTTCCTCTATACCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-1349s1c1
Sequence:CCGGCAGACCTGTTTGACACGGATACTCGAGTATCCGTGTCAAACAGGTCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-522s1c1
Sequence:CCGGGCATCCAATTCAGCAAGTATTCTCGAGAATACTTGCTGAATTGGATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006872.2-300s1c1
Sequence:CCGGGCAATCGTCAACAGCATCATTCTCGAGAATGATGCTGTTGACGATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023630
GTF2A1L MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIA, 1-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023630.2-1036s21c1
Sequence:CCGGGTAACCGATGATGATATTAATCTCGAGATTAATATCATCATCGGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023630.2-1226s21c1
Sequence:CCGGACAACGAGGACCATCAAATAACTCGAGTTATTTGATGGTCCTCGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-1158s1c1
Sequence:CCGGGCGTATCGAATGAAGATTCAACTCGAGTTGAATCTTCATTCGATACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-142s1c1
Sequence:CCGGGCTCTGGGAAACCAAAGTGTTCTCGAGAACACTTTGGTTTCCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-407s1c1
Sequence:CCGGCACCTTTACAAAGTCAATGTACTCGAGTACATTGACTTTGTAAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-1336s1c1
Sequence:CCGGCAGATGGAAATTCTACTTGAACTCGAGTTCAAGTAGAATTTCCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-881s1c1
Sequence:CCGGCAAAGCCTTAAAGACAGTATACTCGAGTATACTGTCTTTAAGGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023630
GTF2A1L MISSION shRNA shRNA Plasmid DNA
general transcription factor IIA, 1-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023630.2-1036s21c1
Sequence:CCGGGTAACCGATGATGATATTAATCTCGAGATTAATATCATCATCGGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023630.2-1226s21c1
Sequence:CCGGACAACGAGGACCATCAAATAACTCGAGTTATTTGATGGTCCTCGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-1158s1c1
Sequence:CCGGGCGTATCGAATGAAGATTCAACTCGAGTTGAATCTTCATTCGATACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-142s1c1
Sequence:CCGGGCTCTGGGAAACCAAAGTGTTCTCGAGAACACTTTGGTTTCCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-407s1c1
Sequence:CCGGCACCTTTACAAAGTCAATGTACTCGAGTACATTGACTTTGTAAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-1336s1c1
Sequence:CCGGCAGATGGAAATTCTACTTGAACTCGAGTTCAAGTAGAATTTCCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-881s1c1
Sequence:CCGGCAAAGCCTTAAAGACAGTATACTCGAGTATACTGTCTTTAAGGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023630
GTF2A1L MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIA, 1-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023630.2-1036s21c1
Sequence:CCGGGTAACCGATGATGATATTAATCTCGAGATTAATATCATCATCGGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023630.2-1226s21c1
Sequence:CCGGACAACGAGGACCATCAAATAACTCGAGTTATTTGATGGTCCTCGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-1158s1c1
Sequence:CCGGGCGTATCGAATGAAGATTCAACTCGAGTTGAATCTTCATTCGATACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-142s1c1
Sequence:CCGGGCTCTGGGAAACCAAAGTGTTCTCGAGAACACTTTGGTTTCCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-407s1c1
Sequence:CCGGCACCTTTACAAAGTCAATGTACTCGAGTACATTGACTTTGTAAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-1336s1c1
Sequence:CCGGCAGATGGAAATTCTACTTGAACTCGAGTTCAAGTAGAATTTCCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023630.1-881s1c1
Sequence:CCGGCAAAGCCTTAAAGACAGTATACTCGAGTATACTGTCTTTAAGGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)