EMAIL THIS PAGE TO A FRIEND

GTF2B

general transcription factor IIB

83 Gene Product Result for
Synonyms: TF2B TFIIB
UniProtKB ID: Q00403, A8K1A7, Q5JS30
Gene ID:
Human(2959) Summary: This gene encodes the general transcription factor IIB, one of the ubiquitous factors required for transcription initiation by RNA polymerase II. The protein localizes to the nucleus where it forms a complex (the DAB complex) with transcription factors IID and IIA. Transcription factor IIB serves as a bridge between IID, the factor which initially recognizes the promoter sequence, and RNA polymerase II. [provided by RefSeq, Jul 2008]
Mouse(229906) general transcription factor IIB
Rat(81673) general transcription factor IIB
sheep(101119003) general transcription factor IIB
domestic guinea pig(100732994) general transcription factor IIB
Zebrafish(324823) general transcription factor IIB
chicken(424518) general transcription factor IIB
cow(513231) general transcription factor IIB
domestic cat(101081913) general transcription factor IIB
dog(479960) general transcription factor IIB
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
G8047 Anti-GTF2B (126-140) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
G7922 Anti-GTF2B (91-105) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2100985 Anti-GTF2B (ab1) antibody produced in rabbit affinity isolated antibody mouse, horse, human, dog, rat, guinea pig, bovine
western blot pricing
SAB2100986 Anti-GTF2B (ab2) antibody produced in rabbit affinity isolated antibody dog, human, mouse, rabbit, pig, horse
western blot pricing
SAB1405906 Anti-GTF2B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV100990 Anti-GTF2B antibody produced in rabbit IgG fraction of antiserum horse, mouse, dog, human, rabbit, guinea pig
immunohistochemistry, western blot pricing
HPA061626 Anti-GTF2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2107314 Anti-GTF2B antibody produced in rabbit affinity isolated antibody human, bovine, mouse, rat, dog, guinea pig, horse
western blot pricing
SAB1410591 Anti-GTF2B antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
SAB5300092 Monoclonal Anti-GTF2B antibody produced in mouse clone 4C1, ascites fluid human, monkey
ELISA, western blot pricing
PLA0271 Rabbit anti-GTF2B/TFIIB Antibody, Affinity Purified human
immunoprecipitation (IP), proximity ligation assay pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001514 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145546 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145546 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145546 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001514 Rosetta Predictions human pricing
NM_031041 Rosetta Predictions rat pricing
NM_145546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073883 predicted 1081
2 SASI_Hs01_00073884 predicted 344
3 SASI_Hs02_00332023 predicted 436
4 SASI_Hs01_00073886 predicted 1045
5 SASI_Hs01_00073887 predicted 474
6 SASI_Hs01_00073888 predicted 580
7 SASI_Hs01_00073889 predicted 587
8 SASI_Hs02_00332024 predicted 226
9 SASI_Hs01_00073890 predicted 512
10 SASI_Hs01_00073891 predicted 271
11 SASI_Hs01_00073885 predicted 787
12 SASI_Hs01_00073892 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031041 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099824 predicted 970
2 SASI_Rn01_00099825 predicted 406
3 SASI_Rn01_00099826 predicted 983
4 SASI_Rn01_00099827 predicted 245
5 SASI_Rn01_00099828 predicted 957
6 SASI_Rn01_00099829 predicted 344
7 SASI_Rn01_00099830 predicted 472
8 SASI_Rn01_00099831 predicted 1000
9 SASI_Rn01_00099832 predicted 649
10 SASI_Rn01_00099833 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077443 predicted 419
2 SASI_Mm01_00077444 predicted 981
3 SASI_Mm01_00077445 predicted 250
4 SASI_Mm01_00077446 predicted 965
5 SASI_Mm01_00077447 predicted 395
6 SASI_Mm01_00077449 predicted 356
7 SASI_Mm01_00077450 predicted 424
8 SASI_Mm01_00077451 predicted 990
9 SASI_Mm01_00077452 predicted 481
10 SASI_Mm02_00341034 predicted 301
11 SASI_Mm01_00077448 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001514
VALIDATED
GTF2B MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIB
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001514.2-195s1c1
Sequence:CCGGCGAACTTTCAGCAATGACAAACTCGAGTTTGTCATTGCTGAAAGTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001514.5-194s21c1
Sequence:CCGGGGACTACAGAGCCGGTGATATCTCGAGATATCACCGGCTCTGTAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001514.5-1080s21c1
Sequence:CCGGGCTAACGTCAAATTCTTGAATCTCGAGATTCAAGAATTTGACGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001514.2-999s1c1
Sequence:CCGGGCTAACGTCAAATTCTTGAATCTCGAGATTCAAGAATTTGACGTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001514.2-641s1c1
Sequence:CCGGGCTAGAAACCAGTGTGGATTTCTCGAGAAATCCACACTGGTTTCTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001514.2-732s1c1
Sequence:CCGGGCTACACATATAGCCCGTAAACTCGAGTTTACGGGCTATATGTGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001514.2-753s1c1
Sequence:CCGGGCTGTGGAATTGGACTTGGTTCTCGAGAACCAAGTCCAATTCCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001514.5-276s21c1
Sequence:CCGGCGAACTTTCAGCAATGACAAACTCGAGTTTGTCATTGCTGAAAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001514.5-501s21c1
Sequence:CCGGATCAATCTACCTCGAAATATACTCGAGTATATTTCGAGGTAGATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001514.5-237s21c1
Sequence:CCGGGTTGTAGGTGACCGGGTTATTCTCGAGAATAACCCGGTCACCTACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001514
VALIDATED
GTF2B MISSION shRNA shRNA Plasmid DNA
general transcription factor IIB
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001514.2-195s1c1
Sequence:CCGGCGAACTTTCAGCAATGACAAACTCGAGTTTGTCATTGCTGAAAGTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001514.5-194s21c1
Sequence:CCGGGGACTACAGAGCCGGTGATATCTCGAGATATCACCGGCTCTGTAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001514.5-1080s21c1
Sequence:CCGGGCTAACGTCAAATTCTTGAATCTCGAGATTCAAGAATTTGACGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001514.2-999s1c1
Sequence:CCGGGCTAACGTCAAATTCTTGAATCTCGAGATTCAAGAATTTGACGTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001514.2-641s1c1
Sequence:CCGGGCTAGAAACCAGTGTGGATTTCTCGAGAAATCCACACTGGTTTCTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001514.2-732s1c1
Sequence:CCGGGCTACACATATAGCCCGTAAACTCGAGTTTACGGGCTATATGTGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001514.2-753s1c1
Sequence:CCGGGCTGTGGAATTGGACTTGGTTCTCGAGAACCAAGTCCAATTCCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001514.5-276s21c1
Sequence:CCGGCGAACTTTCAGCAATGACAAACTCGAGTTTGTCATTGCTGAAAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001514.5-501s21c1
Sequence:CCGGATCAATCTACCTCGAAATATACTCGAGTATATTTCGAGGTAGATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001514.5-237s21c1
Sequence:CCGGGTTGTAGGTGACCGGGTTATTCTCGAGAATAACCCGGTCACCTACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001514
VALIDATED
GTF2B MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIB
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001514.2-195s1c1
Sequence:CCGGCGAACTTTCAGCAATGACAAACTCGAGTTTGTCATTGCTGAAAGTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001514.5-194s21c1
Sequence:CCGGGGACTACAGAGCCGGTGATATCTCGAGATATCACCGGCTCTGTAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001514.5-1080s21c1
Sequence:CCGGGCTAACGTCAAATTCTTGAATCTCGAGATTCAAGAATTTGACGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001514.2-999s1c1
Sequence:CCGGGCTAACGTCAAATTCTTGAATCTCGAGATTCAAGAATTTGACGTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001514.2-641s1c1
Sequence:CCGGGCTAGAAACCAGTGTGGATTTCTCGAGAAATCCACACTGGTTTCTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001514.2-732s1c1
Sequence:CCGGGCTACACATATAGCCCGTAAACTCGAGTTTACGGGCTATATGTGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001514.2-753s1c1
Sequence:CCGGGCTGTGGAATTGGACTTGGTTCTCGAGAACCAAGTCCAATTCCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001514.5-276s21c1
Sequence:CCGGCGAACTTTCAGCAATGACAAACTCGAGTTTGTCATTGCTGAAAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001514.5-501s21c1
Sequence:CCGGATCAATCTACCTCGAAATATACTCGAGTATATTTCGAGGTAGATTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001514.5-237s21c1
Sequence:CCGGGTTGTAGGTGACCGGGTTATTCTCGAGAATAACCCGGTCACCTACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145546
VALIDATED
GTF2B MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIB
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145546.1-72s1c1
Sequence:CCGGCGAATCATCCAGATGCAATTTCTCGAGAAATTGCATCTGGATGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145546.1-114s1c1
Sequence:CCGGGCGATATGATCTGTCCCGAATCTCGAGATTCGGGACAGATCATATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145546.1-190s1c1
Sequence:CCGGCAGCAATGACAAAGCAACAAACTCGAGTTTGTTGCTTTGTCATTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145546.1-589s1c1
Sequence:CCGGGAAAGAAATTGGCCGCTGTTTCTCGAGAAACAGCGGCCAATTTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145546.1-1106s1c1
Sequence:CCGGGCTTAGTCTTCTGTATGTATACTCGAGTATACATACAGAAGACTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145546.1-72s21c1
Sequence:CCGGCGAATCATCCAGATGCAATTTCTCGAGAAATTGCATCTGGATGATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145546.1-1106s21c1
Sequence:CCGGGCTTAGTCTTCTGTATGTATACTCGAGTATACATACAGAAGACTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145546.1-114s21c1
Sequence:CCGGGCGATATGATCTGTCCCGAATCTCGAGATTCGGGACAGATCATATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145546.1-190s21c1
Sequence:CCGGCAGCAATGACAAAGCAACAAACTCGAGTTTGTTGCTTTGTCATTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145546
VALIDATED
GTF2B MISSION shRNA shRNA Plasmid DNA
general transcription factor IIB
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145546.1-72s1c1
Sequence:CCGGCGAATCATCCAGATGCAATTTCTCGAGAAATTGCATCTGGATGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145546.1-114s1c1
Sequence:CCGGGCGATATGATCTGTCCCGAATCTCGAGATTCGGGACAGATCATATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145546.1-190s1c1
Sequence:CCGGCAGCAATGACAAAGCAACAAACTCGAGTTTGTTGCTTTGTCATTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145546.1-589s1c1
Sequence:CCGGGAAAGAAATTGGCCGCTGTTTCTCGAGAAACAGCGGCCAATTTCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145546.1-1106s1c1
Sequence:CCGGGCTTAGTCTTCTGTATGTATACTCGAGTATACATACAGAAGACTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145546.1-72s21c1
Sequence:CCGGCGAATCATCCAGATGCAATTTCTCGAGAAATTGCATCTGGATGATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145546.1-1106s21c1
Sequence:CCGGGCTTAGTCTTCTGTATGTATACTCGAGTATACATACAGAAGACTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145546.1-114s21c1
Sequence:CCGGGCGATATGATCTGTCCCGAATCTCGAGATTCGGGACAGATCATATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145546.1-190s21c1
Sequence:CCGGCAGCAATGACAAAGCAACAAACTCGAGTTTGTTGCTTTGTCATTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145546
VALIDATED
GTF2B MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIB
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145546.1-72s1c1
Sequence:CCGGCGAATCATCCAGATGCAATTTCTCGAGAAATTGCATCTGGATGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145546.1-114s1c1
Sequence:CCGGGCGATATGATCTGTCCCGAATCTCGAGATTCGGGACAGATCATATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145546.1-190s1c1
Sequence:CCGGCAGCAATGACAAAGCAACAAACTCGAGTTTGTTGCTTTGTCATTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145546.1-589s1c1
Sequence:CCGGGAAAGAAATTGGCCGCTGTTTCTCGAGAAACAGCGGCCAATTTCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145546.1-1106s1c1
Sequence:CCGGGCTTAGTCTTCTGTATGTATACTCGAGTATACATACAGAAGACTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145546.1-72s21c1
Sequence:CCGGCGAATCATCCAGATGCAATTTCTCGAGAAATTGCATCTGGATGATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145546.1-1106s21c1
Sequence:CCGGGCTTAGTCTTCTGTATGTATACTCGAGTATACATACAGAAGACTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145546.1-114s21c1
Sequence:CCGGGCGATATGATCTGTCCCGAATCTCGAGATTCGGGACAGATCATATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145546.1-190s21c1
Sequence:CCGGCAGCAATGACAAAGCAACAAACTCGAGTTTGTTGCTTTGTCATTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)