EMAIL THIS PAGE TO A FRIEND

GTF2E1

general transcription factor IIE, polypeptide 1, alpha 56kDa

167 Gene Product Result for
Synonyms: FE TF2E1 TFIIE-A
UniProtKB ID: P29083, Q16103
Gene ID:
Mouse(74197) general transcription factor II E, polypeptide 1 (alpha subunit)
Rat(303918) general transcription factor IIE, polypeptide 1 (alpha subunit)
Zebrafish(567899) general transcription factor IIE, polypeptide 1, alpha
cow(540525) general transcription factor IIE, polypeptide 1, alpha 56kDa
domestic cat(101083539) general transcription factor IIE, polypeptide 1, alpha 56kDa
dog(488002) general transcription factor IIE, polypeptide 1, alpha 56kDa
chicken(418328) general transcription factor IIE, polypeptide 1, alpha 56kDa
domestic guinea pig(100715976) general transcription factor IIE, polypeptide 1, alpha 56kDa
naked mole-rat(101725574) general transcription factor IIE, polypeptide 1, alpha 56kDa
sheep(101109136) general transcription factor IIE, polypeptide 1, alpha 56kDa
Domestic Rabbit(100343990) general transcription factor IIE, polypeptide 1, alpha 56kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005513 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005513 Rosetta Predictions human pricing
XM_001062046 Rosetta Predictions rat pricing
XM_221426 Rosetta Predictions rat pricing
NM_028812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182032 predicted 708
2 SASI_Hs01_00182033 predicted 943
3 SASI_Hs01_00182034 predicted 499
4 SASI_Hs01_00182035 predicted 279
5 SASI_Hs01_00182036 predicted 585
6 SASI_Hs01_00182037 predicted 1428
7 SASI_Hs01_00182038 predicted 889
8 SASI_Hs02_00339727 predicted 246
9 SASI_Hs01_00182039 predicted 1423
10 SASI_Hs01_00182040 predicted 1378
11 SASI_Hs01_00182041 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302190 predicted 761
2 SASI_Rn02_00302191 predicted 889
3 SASI_Rn02_00302192 predicted 902
4 SASI_Rn02_00302193 predicted 242
5 SASI_Rn02_00302194 predicted 449
6 SASI_Rn02_00302195 predicted 743
7 SASI_Rn02_00302196 predicted 1128
8 SASI_Rn02_00302197 predicted 688
9 SASI_Rn02_00302198 predicted 365
10 SASI_Rn02_00302199 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380115 predicted 761
2 SASI_Rn02_00380116 predicted 885
3 SASI_Rn02_00380117 predicted 899
4 SASI_Rn02_00380118 predicted 249
5 SASI_Rn02_00380119 predicted 450
6 SASI_Rn02_00380120 predicted 747
7 SASI_Rn02_00380121 predicted 1127
8 SASI_Rn02_00380122 predicted 693
9 SASI_Rn02_00380123 predicted 360
10 SASI_Rn02_00380124 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066638 predicted 909
2 SASI_Mm01_00066639 predicted 899
3 SASI_Mm02_00334428 predicted 541
4 SASI_Mm01_00066640 predicted 1112
5 SASI_Mm01_00066641 predicted 1030
6 SASI_Mm01_00066642 predicted 620
7 SASI_Mm01_00066643 predicted 1432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005513
VALIDATED
GTF2E1 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIE, polypeptide 1, alpha 56kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005513.1-2565s1c1
Sequence:CCGGCCAGCAGAAATCAACAGAATACTCGAGTATTCTGTTGATTTCTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005513.1-1024s1c1
Sequence:CCGGGCACTGCTCATTCACGAGAAACTCGAGTTTCTCGTGAATGAGCAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005513.1-318s1c1
Sequence:CCGGCCATAACTACTACTTCATCAACTCGAGTTGATGAAGTAGTAGTTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005513.1-176s1c1
Sequence:CCGGCCTGTGTGAAAGAGGAGGATACTCGAGTATCCTCCTCTTTCACACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005513.1-1348s1c1
Sequence:CCGGCGCATGTTTGAGGACCTCTTTCTCGAGAAAGAGGTCCTCAAACATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005513.2-378s21c1
Sequence:CCGGCCATAACTACTACTTCATCAACTCGAGTTGATGAAGTAGTAGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005513.2-2626s21c1
Sequence:CCGGCCAGCAGAAATCAACAGAATACTCGAGTATTCTGTTGATTTCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005513.2-236s21c1
Sequence:CCGGCCTGTGTGAAAGAGGAGGATACTCGAGTATCCTCCTCTTTCACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005513.2-1408s21c1
Sequence:CCGGCGCATGTTTGAGGACCTCTTTCTCGAGAAAGAGGTCCTCAAACATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005513.2-1084s21c1
Sequence:CCGGGCACTGCTCATTCACGAGAAACTCGAGTTTCTCGTGAATGAGCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005513
VALIDATED
GTF2E1 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIE, polypeptide 1, alpha 56kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005513.1-2565s1c1
Sequence:CCGGCCAGCAGAAATCAACAGAATACTCGAGTATTCTGTTGATTTCTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005513.1-1024s1c1
Sequence:CCGGGCACTGCTCATTCACGAGAAACTCGAGTTTCTCGTGAATGAGCAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005513.1-318s1c1
Sequence:CCGGCCATAACTACTACTTCATCAACTCGAGTTGATGAAGTAGTAGTTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005513.1-176s1c1
Sequence:CCGGCCTGTGTGAAAGAGGAGGATACTCGAGTATCCTCCTCTTTCACACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005513.1-1348s1c1
Sequence:CCGGCGCATGTTTGAGGACCTCTTTCTCGAGAAAGAGGTCCTCAAACATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005513.2-378s21c1
Sequence:CCGGCCATAACTACTACTTCATCAACTCGAGTTGATGAAGTAGTAGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005513.2-2626s21c1
Sequence:CCGGCCAGCAGAAATCAACAGAATACTCGAGTATTCTGTTGATTTCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005513.2-236s21c1
Sequence:CCGGCCTGTGTGAAAGAGGAGGATACTCGAGTATCCTCCTCTTTCACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005513.2-1408s21c1
Sequence:CCGGCGCATGTTTGAGGACCTCTTTCTCGAGAAAGAGGTCCTCAAACATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005513.2-1084s21c1
Sequence:CCGGGCACTGCTCATTCACGAGAAACTCGAGTTTCTCGTGAATGAGCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005513
VALIDATED
GTF2E1 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIE, polypeptide 1, alpha 56kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005513.1-2565s1c1
Sequence:CCGGCCAGCAGAAATCAACAGAATACTCGAGTATTCTGTTGATTTCTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005513.1-1024s1c1
Sequence:CCGGGCACTGCTCATTCACGAGAAACTCGAGTTTCTCGTGAATGAGCAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005513.1-318s1c1
Sequence:CCGGCCATAACTACTACTTCATCAACTCGAGTTGATGAAGTAGTAGTTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005513.1-176s1c1
Sequence:CCGGCCTGTGTGAAAGAGGAGGATACTCGAGTATCCTCCTCTTTCACACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005513.1-1348s1c1
Sequence:CCGGCGCATGTTTGAGGACCTCTTTCTCGAGAAAGAGGTCCTCAAACATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005513.2-378s21c1
Sequence:CCGGCCATAACTACTACTTCATCAACTCGAGTTGATGAAGTAGTAGTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277957    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005513.2-2626s21c1
Sequence:CCGGCCAGCAGAAATCAACAGAATACTCGAGTATTCTGTTGATTTCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005513.2-236s21c1
Sequence:CCGGCCTGTGTGAAAGAGGAGGATACTCGAGTATCCTCCTCTTTCACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005513.2-1408s21c1
Sequence:CCGGCGCATGTTTGAGGACCTCTTTCTCGAGAAAGAGGTCCTCAAACATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005513.2-1084s21c1
Sequence:CCGGGCACTGCTCATTCACGAGAAACTCGAGTTTCTCGTGAATGAGCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028812
GTF2E1 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIE, polypeptide 1, alpha 56kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028812.1-2617s1c1
Sequence:CCGGCCTTGTATAAAGTGATGACATCTCGAGATGTCATCACTTTATACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028812.1-1440s1c1
Sequence:CCGGCGTATGTTTGAGGATCTCTTTCTCGAGAAAGAGATCCTCAAACATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028812.1-561s1c1
Sequence:CCGGGAAGCCAATCAACTGTTTGATCTCGAGATCAAACAGTTGATTGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028812.1-552s1c1
Sequence:CCGGACTGACCTAGAAGCCAATCAACTCGAGTTGATTGGCTTCTAGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028812.1-1266s1c1
Sequence:CCGGCCTCATCATCATCGCGATGAACTCGAGTTCATCGCGATGATGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028812.3-1265s21c1
Sequence:CCGGCCTCATCATCATCGCGATGAACTCGAGTTCATCGCGATGATGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028812.3-1439s21c1
Sequence:CCGGCGTATGTTTGAGGATCTCTTTCTCGAGAAAGAGATCCTCAAACATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028812.3-551s21c1
Sequence:CCGGACTGACCTAGAAGCCAATCAACTCGAGTTGATTGGCTTCTAGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028812.3-2616s21c1
Sequence:CCGGCCTTGTATAAAGTGATGACATCTCGAGATGTCATCACTTTATACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028812
GTF2E1 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIE, polypeptide 1, alpha 56kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028812.1-2617s1c1
Sequence:CCGGCCTTGTATAAAGTGATGACATCTCGAGATGTCATCACTTTATACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028812.1-1440s1c1
Sequence:CCGGCGTATGTTTGAGGATCTCTTTCTCGAGAAAGAGATCCTCAAACATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028812.1-561s1c1
Sequence:CCGGGAAGCCAATCAACTGTTTGATCTCGAGATCAAACAGTTGATTGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028812.1-552s1c1
Sequence:CCGGACTGACCTAGAAGCCAATCAACTCGAGTTGATTGGCTTCTAGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028812.1-1266s1c1
Sequence:CCGGCCTCATCATCATCGCGATGAACTCGAGTTCATCGCGATGATGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028812.3-1265s21c1
Sequence:CCGGCCTCATCATCATCGCGATGAACTCGAGTTCATCGCGATGATGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028812.3-1439s21c1
Sequence:CCGGCGTATGTTTGAGGATCTCTTTCTCGAGAAAGAGATCCTCAAACATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028812.3-551s21c1
Sequence:CCGGACTGACCTAGAAGCCAATCAACTCGAGTTGATTGGCTTCTAGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028812.3-2616s21c1
Sequence:CCGGCCTTGTATAAAGTGATGACATCTCGAGATGTCATCACTTTATACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028812
GTF2E1 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIE, polypeptide 1, alpha 56kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085168    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028812.1-2617s1c1
Sequence:CCGGCCTTGTATAAAGTGATGACATCTCGAGATGTCATCACTTTATACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028812.1-1440s1c1
Sequence:CCGGCGTATGTTTGAGGATCTCTTTCTCGAGAAAGAGATCCTCAAACATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028812.1-561s1c1
Sequence:CCGGGAAGCCAATCAACTGTTTGATCTCGAGATCAAACAGTTGATTGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028812.1-552s1c1
Sequence:CCGGACTGACCTAGAAGCCAATCAACTCGAGTTGATTGGCTTCTAGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028812.1-1266s1c1
Sequence:CCGGCCTCATCATCATCGCGATGAACTCGAGTTCATCGCGATGATGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028812.3-1265s21c1
Sequence:CCGGCCTCATCATCATCGCGATGAACTCGAGTTCATCGCGATGATGATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028812.3-1439s21c1
Sequence:CCGGCGTATGTTTGAGGATCTCTTTCTCGAGAAAGAGATCCTCAAACATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028812.3-551s21c1
Sequence:CCGGACTGACCTAGAAGCCAATCAACTCGAGTTGATTGGCTTCTAGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028812.3-2616s21c1
Sequence:CCGGCCTTGTATAAAGTGATGACATCTCGAGATGTCATCACTTTATACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)