EMAIL THIS PAGE TO A FRIEND

GTF2E2

general transcription factor IIE, polypeptide 2, beta 34kDa

81 Gene Product Result for
Synonyms: FE TF2E2 TFIIE-B
UniProtKB ID: P29084, D3DSV2, Q9H2B9
Gene ID:
Mouse(68153) general transcription factor II E, polypeptide 2 (beta subunit)
Rat(306516) general transcription factor IIE, polypeptide 2, beta
Goat(100861358) general transcription factor IIE, polypeptide 2, beta 34kDa
Zebrafish(334854) general transcription factor IIE, polypeptide 2, beta
dog(475597) general transcription factor IIE, polypeptide 2, beta 34kDa
cow(510921) general transcription factor IIE, polypeptide 2, beta 34kDa
chicken(771227) general transcription factor IIE, polypeptide 2, beta 34kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002095 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002095 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002095 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026584 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026584 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026584 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002095 Rosetta Predictions human pricing
NM_001107318 Rosetta Predictions rat pricing
NM_026584 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002095 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118088 predicted 702
2 SASI_Hs01_00118089 predicted 1100
3 SASI_Hs01_00118090 predicted 1148
4 SASI_Hs01_00118091 predicted 665
5 SASI_Hs01_00118092 predicted 658
6 SASI_Hs01_00118093 predicted 1191
7 SASI_Hs01_00118094 predicted 1118
8 SASI_Hs01_00118095 predicted 1153
9 SASI_Hs01_00118096 predicted 1089
10 SASI_Hs01_00118097 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227655 predicted 457
2 SASI_Rn02_00227656 predicted 389
3 SASI_Rn02_00227657 predicted 386
4 SASI_Rn02_00227658 predicted 256
5 SASI_Rn02_00227659 predicted 343
6 SASI_Rn02_00227660 predicted 854
7 SASI_Rn02_00227661 predicted 437
8 SASI_Rn02_00227662 predicted 945
9 SASI_Rn02_00227663 predicted 377
10 SASI_Rn02_00227664 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063095 predicted 324
2 SASI_Mm01_00063096 predicted 259
3 SASI_Mm01_00063097 predicted 460
4 SASI_Mm01_00063098 predicted 268
5 SASI_Mm01_00063099 predicted 954
6 SASI_Mm01_00063100 predicted 897
7 SASI_Mm01_00063101 predicted 308
8 SASI_Mm01_00063102 predicted 620
9 SASI_Mm01_00063103 predicted 649
10 SASI_Mm01_00063104 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002095
VALIDATED
GTF2E2 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIE, polypeptide 2, beta 34kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002095.4-823s21c1
Sequence:CCGGATTTGTAAATCGTCCCGATAACTCGAGTTATCGGGACGATTTACAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002095.4-723s21c1
Sequence:CCGGAGCATGACCAGCGAGGATTAGCTCGAGCTAATCCTCGCTGGTCATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002095.4-419s21c1
Sequence:CCGGGATCATAGCAATGGATCATTTCTCGAGAAATGATCCATTGCTATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002095.4-961s21c1
Sequence:CCGGTCTGAAGCGACAGGGTATTTCCTCGAGGAAATACCCTGTCGCTTCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002095.3-1136s1c1
Sequence:CCGGCCCTGGAACAGAGTTACAGATCTCGAGATCTGTAACTCTGTTCCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002095.3-1048s1c1
Sequence:CCGGGCGACGCTTTAAGACTCATAACTCGAGTTATGAGTCTTAAAGCGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002095.3-695s1c1
Sequence:CCGGGCCCTACTTAGGCTCTTAGATCTCGAGATCTAAGAGCCTAAGTAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002095.3-533s1c1
Sequence:CCGGCCTCTAACCTTAGATGAAATTCTCGAGAATTTCATCTAAGGTTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002095.3-614s1c1
Sequence:CCGGGCTTTAGTCAACAATCCCAAACTCGAGTTTGGGATTGTTGACTAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002095
VALIDATED
GTF2E2 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIE, polypeptide 2, beta 34kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002095.4-823s21c1
Sequence:CCGGATTTGTAAATCGTCCCGATAACTCGAGTTATCGGGACGATTTACAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002095.4-723s21c1
Sequence:CCGGAGCATGACCAGCGAGGATTAGCTCGAGCTAATCCTCGCTGGTCATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002095.4-419s21c1
Sequence:CCGGGATCATAGCAATGGATCATTTCTCGAGAAATGATCCATTGCTATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002095.4-961s21c1
Sequence:CCGGTCTGAAGCGACAGGGTATTTCCTCGAGGAAATACCCTGTCGCTTCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002095.3-1136s1c1
Sequence:CCGGCCCTGGAACAGAGTTACAGATCTCGAGATCTGTAACTCTGTTCCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002095.3-1048s1c1
Sequence:CCGGGCGACGCTTTAAGACTCATAACTCGAGTTATGAGTCTTAAAGCGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002095.3-695s1c1
Sequence:CCGGGCCCTACTTAGGCTCTTAGATCTCGAGATCTAAGAGCCTAAGTAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002095.3-533s1c1
Sequence:CCGGCCTCTAACCTTAGATGAAATTCTCGAGAATTTCATCTAAGGTTAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002095.3-614s1c1
Sequence:CCGGGCTTTAGTCAACAATCCCAAACTCGAGTTTGGGATTGTTGACTAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002095
VALIDATED
GTF2E2 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIE, polypeptide 2, beta 34kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002095.4-823s21c1
Sequence:CCGGATTTGTAAATCGTCCCGATAACTCGAGTTATCGGGACGATTTACAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002095.4-723s21c1
Sequence:CCGGAGCATGACCAGCGAGGATTAGCTCGAGCTAATCCTCGCTGGTCATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002095.4-419s21c1
Sequence:CCGGGATCATAGCAATGGATCATTTCTCGAGAAATGATCCATTGCTATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002095.4-961s21c1
Sequence:CCGGTCTGAAGCGACAGGGTATTTCCTCGAGGAAATACCCTGTCGCTTCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002095.3-1136s1c1
Sequence:CCGGCCCTGGAACAGAGTTACAGATCTCGAGATCTGTAACTCTGTTCCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002095.3-1048s1c1
Sequence:CCGGGCGACGCTTTAAGACTCATAACTCGAGTTATGAGTCTTAAAGCGTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002095.3-695s1c1
Sequence:CCGGGCCCTACTTAGGCTCTTAGATCTCGAGATCTAAGAGCCTAAGTAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002095.3-533s1c1
Sequence:CCGGCCTCTAACCTTAGATGAAATTCTCGAGAATTTCATCTAAGGTTAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002095.3-614s1c1
Sequence:CCGGGCTTTAGTCAACAATCCCAAACTCGAGTTTGGGATTGTTGACTAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026584
VALIDATED
GTF2E2 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIE, polypeptide 2, beta 34kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026584.2-509s21c1
Sequence:CCGGCTTCAAACCTAAGTACAACTTCTCGAGAAGTTGTACTTAGGTTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026584.2-935s21c1
Sequence:CCGGGCTGAAGGATTACTCGGACATCTCGAGATGTCCGAGTAATCCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026584.2-462s21c1
Sequence:CCGGGCTTTAGTCAACAATCCTAAACTCGAGTTTAGGATTGTTGACTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026584.2-897s21c1
Sequence:CCGGCGACGGTTTAAGACTCACAATCTCGAGATTGTGAGTCTTAAACCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026584.2-1164s1c1
Sequence:CCGGCCTGTTTAACTTTCTGGGTTTCTCGAGAAACCCAGAAAGTTAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026584.2-462s1c1
Sequence:CCGGGCTTTAGTCAACAATCCTAAACTCGAGTTTAGGATTGTTGACTAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026584.2-935s1c1
Sequence:CCGGGCTGAAGGATTACTCGGACATCTCGAGATGTCCGAGTAATCCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026584.2-897s1c1
Sequence:CCGGCGACGGTTTAAGACTCACAATCTCGAGATTGTGAGTCTTAAACCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026584.2-509s1c1
Sequence:CCGGCTTCAAACCTAAGTACAACTTCTCGAGAAGTTGTACTTAGGTTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026584
VALIDATED
GTF2E2 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIE, polypeptide 2, beta 34kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026584.2-509s21c1
Sequence:CCGGCTTCAAACCTAAGTACAACTTCTCGAGAAGTTGTACTTAGGTTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026584.2-935s21c1
Sequence:CCGGGCTGAAGGATTACTCGGACATCTCGAGATGTCCGAGTAATCCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026584.2-462s21c1
Sequence:CCGGGCTTTAGTCAACAATCCTAAACTCGAGTTTAGGATTGTTGACTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026584.2-897s21c1
Sequence:CCGGCGACGGTTTAAGACTCACAATCTCGAGATTGTGAGTCTTAAACCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026584.2-1164s1c1
Sequence:CCGGCCTGTTTAACTTTCTGGGTTTCTCGAGAAACCCAGAAAGTTAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026584.2-462s1c1
Sequence:CCGGGCTTTAGTCAACAATCCTAAACTCGAGTTTAGGATTGTTGACTAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026584.2-935s1c1
Sequence:CCGGGCTGAAGGATTACTCGGACATCTCGAGATGTCCGAGTAATCCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026584.2-897s1c1
Sequence:CCGGCGACGGTTTAAGACTCACAATCTCGAGATTGTGAGTCTTAAACCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026584.2-509s1c1
Sequence:CCGGCTTCAAACCTAAGTACAACTTCTCGAGAAGTTGTACTTAGGTTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026584
VALIDATED
GTF2E2 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIE, polypeptide 2, beta 34kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026584.2-509s21c1
Sequence:CCGGCTTCAAACCTAAGTACAACTTCTCGAGAAGTTGTACTTAGGTTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026584.2-935s21c1
Sequence:CCGGGCTGAAGGATTACTCGGACATCTCGAGATGTCCGAGTAATCCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026584.2-462s21c1
Sequence:CCGGGCTTTAGTCAACAATCCTAAACTCGAGTTTAGGATTGTTGACTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026584.2-897s21c1
Sequence:CCGGCGACGGTTTAAGACTCACAATCTCGAGATTGTGAGTCTTAAACCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026584.2-1164s1c1
Sequence:CCGGCCTGTTTAACTTTCTGGGTTTCTCGAGAAACCCAGAAAGTTAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026584.2-462s1c1
Sequence:CCGGGCTTTAGTCAACAATCCTAAACTCGAGTTTAGGATTGTTGACTAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026584.2-935s1c1
Sequence:CCGGGCTGAAGGATTACTCGGACATCTCGAGATGTCCGAGTAATCCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026584.2-897s1c1
Sequence:CCGGCGACGGTTTAAGACTCACAATCTCGAGATTGTGAGTCTTAAACCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026584.2-509s1c1
Sequence:CCGGCTTCAAACCTAAGTACAACTTCTCGAGAAGTTGTACTTAGGTTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)