EMAIL THIS PAGE TO A FRIEND

GTF2F1

general transcription factor IIF, polypeptide 1, 74kDa

57 Gene Product Result for
Synonyms: BTF4 RAP74 TF2F1 TFIIF
UniProtKB ID: P35269, B2RCS0, Q9BWN0
Gene ID:
Mouse(98053) general transcription factor IIF, polypeptide 1
Rat(316123) general transcription factor IIF, polypeptide 1
Zebrafish(325832) general transcription factor IIF, polypeptide 1
dog(476731) general transcription factor IIF, polypeptide 1, 74kDa
cow(505702) general transcription factor IIF, polypeptide 1, 74kDa
domestic cat(101095797) general transcription factor IIF, polypeptide 1, 74kDa
domestic guinea pig(100722026) general transcription factor IIF, polypeptide 1, 74kDa
naked mole-rat(101710670) general transcription factor IIF, polypeptide 1, 74kDa
sheep(101106073) general transcription factor IIF, polypeptide 1, 74kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002096 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002096 Rosetta Predictions human pricing
NM_001007711 Rosetta Predictions rat pricing
NM_133801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174946 predicted 600
2 SASI_Hs01_00174947 predicted 1761
3 SASI_Hs01_00174948 predicted 329
4 SASI_Hs01_00174949 predicted 606
5 SASI_Hs01_00174951 predicted 1689
6 SASI_Hs01_00174952 predicted 923
7 SASI_Hs02_00333190 predicted 1745
8 SASI_Hs01_00174953 predicted 317
9 SASI_Hs01_00174954 predicted 1599
10 SASI_Hs02_00333191 predicted 633
11 SASI_Hs01_00174950 predicted 1797
12 SASI_Hs01_00174955 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062632 predicted 539
2 SASI_Rn01_00062633 predicted 262
3 SASI_Rn01_00062634 predicted 621
4 SASI_Rn01_00062635 predicted 314
5 SASI_Rn01_00062636 predicted 715
6 SASI_Rn01_00062637 predicted 478
7 SASI_Rn01_00062638 predicted 442
8 SASI_Rn01_00062640 predicted 410
9 SASI_Rn01_00062641 predicted 627
10 SASI_Rn02_00198886 predicted 267
11 SASI_Rn01_00062639 predicted 1443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143102 predicted 581
2 SASI_Mm01_00143103 predicted 591
3 SASI_Mm01_00143105 predicted 200
4 SASI_Mm01_00143106 predicted 576
5 SASI_Mm01_00143104 predicted 459
6 SASI_Mm02_00338830 predicted 370
7 SASI_Mm01_00143108 predicted 1419
8 SASI_Mm01_00143109 predicted 368
9 SASI_Mm01_00143110 predicted 700
10 SASI_Mm01_00143111 predicted 1412
11 SASI_Mm01_00143107 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002096
GTF2F1 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIF, polypeptide 1, 74kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002096.1-2088s1c1
Sequence:CCGGGCTGTGACTTATCCACCACATCTCGAGATGTGGTGGATAAGTCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002096.1-279s1c1
Sequence:CCGGCCGACAAAGTCAACTTTGCTACTCGAGTAGCAAAGTTGACTTTGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002096.1-1687s1c1
Sequence:CCGGGCGCAAGATGATCAACGACAACTCGAGTTGTCGTTGATCATCTTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002096.1-688s1c1
Sequence:CCGGGCTGAACCACTTCAGCATCATCTCGAGATGATGCTGAAGTGGTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002096.1-322s1c1
Sequence:CCGGGCGGGACTTGAGCAACAAGAACTCGAGTTCTTGTTGCTCAAGTCCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002096.2-2195s21c1
Sequence:CCGGGCTGTGACTTATCCACCACATCTCGAGATGTGGTGGATAAGTCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002096.2-386s21c1
Sequence:CCGGCCGACAAAGTCAACTTTGCTACTCGAGTAGCAAAGTTGACTTTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002096.2-1794s21c1
Sequence:CCGGGCGCAAGATGATCAACGACAACTCGAGTTGTCGTTGATCATCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002096.2-429s21c1
Sequence:CCGGGCGGGACTTGAGCAACAAGAACTCGAGTTCTTGTTGCTCAAGTCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002096
GTF2F1 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIF, polypeptide 1, 74kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002096.1-2088s1c1
Sequence:CCGGGCTGTGACTTATCCACCACATCTCGAGATGTGGTGGATAAGTCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002096.1-279s1c1
Sequence:CCGGCCGACAAAGTCAACTTTGCTACTCGAGTAGCAAAGTTGACTTTGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002096.1-1687s1c1
Sequence:CCGGGCGCAAGATGATCAACGACAACTCGAGTTGTCGTTGATCATCTTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002096.1-688s1c1
Sequence:CCGGGCTGAACCACTTCAGCATCATCTCGAGATGATGCTGAAGTGGTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002096.1-322s1c1
Sequence:CCGGGCGGGACTTGAGCAACAAGAACTCGAGTTCTTGTTGCTCAAGTCCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002096.2-2195s21c1
Sequence:CCGGGCTGTGACTTATCCACCACATCTCGAGATGTGGTGGATAAGTCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002096.2-386s21c1
Sequence:CCGGCCGACAAAGTCAACTTTGCTACTCGAGTAGCAAAGTTGACTTTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002096.2-1794s21c1
Sequence:CCGGGCGCAAGATGATCAACGACAACTCGAGTTGTCGTTGATCATCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002096.2-429s21c1
Sequence:CCGGGCGGGACTTGAGCAACAAGAACTCGAGTTCTTGTTGCTCAAGTCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002096
GTF2F1 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIF, polypeptide 1, 74kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020834    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002096.1-2088s1c1
Sequence:CCGGGCTGTGACTTATCCACCACATCTCGAGATGTGGTGGATAAGTCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002096.1-279s1c1
Sequence:CCGGCCGACAAAGTCAACTTTGCTACTCGAGTAGCAAAGTTGACTTTGTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002096.1-1687s1c1
Sequence:CCGGGCGCAAGATGATCAACGACAACTCGAGTTGTCGTTGATCATCTTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002096.1-688s1c1
Sequence:CCGGGCTGAACCACTTCAGCATCATCTCGAGATGATGCTGAAGTGGTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002096.1-322s1c1
Sequence:CCGGGCGGGACTTGAGCAACAAGAACTCGAGTTCTTGTTGCTCAAGTCCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349581    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002096.2-2195s21c1
Sequence:CCGGGCTGTGACTTATCCACCACATCTCGAGATGTGGTGGATAAGTCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002096.2-386s21c1
Sequence:CCGGCCGACAAAGTCAACTTTGCTACTCGAGTAGCAAAGTTGACTTTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002096.2-1794s21c1
Sequence:CCGGGCGCAAGATGATCAACGACAACTCGAGTTGTCGTTGATCATCTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002096.2-429s21c1
Sequence:CCGGGCGGGACTTGAGCAACAAGAACTCGAGTTCTTGTTGCTCAAGTCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133801
VALIDATED
GTF2F1 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIF, polypeptide 1, 74kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133801.1-265s1c1
Sequence:CCGGGCAGCCGATAAAGTCAACTTTCTCGAGAAAGTTGACTTTATCGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133801.1-583s1c1
Sequence:CCGGCCTGTACAGAACTGGTACAATCTCGAGATTGTACCAGTTCTGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133801.1-474s1c1
Sequence:CCGGCAATGGCAAATCAGGACGGAACTCGAGTTCCGTCCTGATTTGCCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133801.1-486s1c1
Sequence:CCGGAGGACGGAAGTTCAAAGGCATCTCGAGATGCCTTTGAACTTCCGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133801.1-678s1c1
Sequence:CCGGCCTAAACCACTTCAGCATCATCTCGAGATGATGCTGAAGTGGTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133801.2-265s21c1
Sequence:CCGGGCAGCCGATAAAGTCAACTTTCTCGAGAAAGTTGACTTTATCGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133801.2-583s21c1
Sequence:CCGGCCTGTACAGAACTGGTACAATCTCGAGATTGTACCAGTTCTGTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133801.2-486s21c1
Sequence:CCGGAGGACGGAAGTTCAAAGGCATCTCGAGATGCCTTTGAACTTCCGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133801.2-678s21c1
Sequence:CCGGCCTAAACCACTTCAGCATCATCTCGAGATGATGCTGAAGTGGTTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133801
VALIDATED
GTF2F1 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIF, polypeptide 1, 74kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133801.1-265s1c1
Sequence:CCGGGCAGCCGATAAAGTCAACTTTCTCGAGAAAGTTGACTTTATCGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133801.1-583s1c1
Sequence:CCGGCCTGTACAGAACTGGTACAATCTCGAGATTGTACCAGTTCTGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133801.1-474s1c1
Sequence:CCGGCAATGGCAAATCAGGACGGAACTCGAGTTCCGTCCTGATTTGCCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133801.1-486s1c1
Sequence:CCGGAGGACGGAAGTTCAAAGGCATCTCGAGATGCCTTTGAACTTCCGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133801.1-678s1c1
Sequence:CCGGCCTAAACCACTTCAGCATCATCTCGAGATGATGCTGAAGTGGTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133801.2-265s21c1
Sequence:CCGGGCAGCCGATAAAGTCAACTTTCTCGAGAAAGTTGACTTTATCGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133801.2-583s21c1
Sequence:CCGGCCTGTACAGAACTGGTACAATCTCGAGATTGTACCAGTTCTGTACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133801.2-486s21c1
Sequence:CCGGAGGACGGAAGTTCAAAGGCATCTCGAGATGCCTTTGAACTTCCGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133801.2-678s21c1
Sequence:CCGGCCTAAACCACTTCAGCATCATCTCGAGATGATGCTGAAGTGGTTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133801
VALIDATED
GTF2F1 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIF, polypeptide 1, 74kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133801.1-265s1c1
Sequence:CCGGGCAGCCGATAAAGTCAACTTTCTCGAGAAAGTTGACTTTATCGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133801.1-583s1c1
Sequence:CCGGCCTGTACAGAACTGGTACAATCTCGAGATTGTACCAGTTCTGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133801.1-474s1c1
Sequence:CCGGCAATGGCAAATCAGGACGGAACTCGAGTTCCGTCCTGATTTGCCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133801.1-486s1c1
Sequence:CCGGAGGACGGAAGTTCAAAGGCATCTCGAGATGCCTTTGAACTTCCGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133801.1-678s1c1
Sequence:CCGGCCTAAACCACTTCAGCATCATCTCGAGATGATGCTGAAGTGGTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133801.2-265s21c1
Sequence:CCGGGCAGCCGATAAAGTCAACTTTCTCGAGAAAGTTGACTTTATCGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133801.2-583s21c1
Sequence:CCGGCCTGTACAGAACTGGTACAATCTCGAGATTGTACCAGTTCTGTACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133801.2-486s21c1
Sequence:CCGGAGGACGGAAGTTCAAAGGCATCTCGAGATGCCTTTGAACTTCCGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133801.2-678s21c1
Sequence:CCGGCCTAAACCACTTCAGCATCATCTCGAGATGATGCTGAAGTGGTTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)