EMAIL THIS PAGE TO A FRIEND

GTF2F2

general transcription factor IIF, polypeptide 2, 30kDa

67 Gene Product Result for
Synonyms: BTF4 RAP30 TF2F2 TFIIF
UniProtKB ID: P13984, A6NNS5, Q5W0H3
Gene ID:
Mouse(68705) general transcription factor IIF, polypeptide 2
Rat(81674) general transcription factor IIF, polypeptide 2
sheep(101110854) general transcription factor IIF, polypeptide 2, 30kDa
domestic guinea pig(100715926) general transcription factor IIF, polypeptide 2, 30kDa
naked mole-rat(101716468) general transcription factor IIF, polypeptide 2, 30kDa
chicken(418843) general transcription factor IIF, polypeptide 2, 30kDa
domestic cat(101083822) general transcription factor IIF, polypeptide 2, 30kDa
cow(509259) general transcription factor IIF, polypeptide 2, 30kDa
dog(609164) general transcription factor IIF, polypeptide 2, 30kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004128 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU097441 MISSION® esiRNA esiRNA human GTF2F2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004128 Rosetta Predictions human pricing
NM_031042 Rosetta Predictions rat pricing
NM_026816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050196 predicted 574
2 SASI_Hs01_00050198 predicted 687
3 SASI_Hs01_00050199 predicted 279
4 SASI_Hs01_00050200 predicted 566
5 SASI_Hs01_00050201 predicted 690
6 SASI_Hs02_00336979 predicted 934
7 SASI_Hs01_00050202 predicted 408
8 SASI_Hs01_00050203 predicted 288
9 SASI_Hs02_00336980 predicted 370
10 SASI_Hs02_00336981 predicted 538
11 SASI_Hs01_00050194 predicted 924
12 SASI_Hs01_00050195 predicted 365
13 SASI_Hs01_00050197 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048545 predicted 412
2 SASI_Rn01_00048547 predicted 480
3 SASI_Rn01_00048548 predicted 557
4 SASI_Rn01_00048549 predicted 681
5 SASI_Rn01_00048550 predicted 489
6 SASI_Rn01_00048551 predicted 546
7 SASI_Rn01_00048552 predicted 386
8 SASI_Rn01_00048553 predicted 515
9 SASI_Rn01_00048554 predicted 820
10 SASI_Rn02_00264264 predicted 531
11 SASI_Rn01_00048546 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330958 predicted 552
2 SASI_Mm01_00028322 predicted 563
3 SASI_Mm01_00028323 predicted 542
4 SASI_Mm01_00028324 predicted 361
5 SASI_Mm02_00330959 predicted 834
6 SASI_Mm01_00028325 predicted 584
7 SASI_Mm01_00028327 predicted 543
8 SASI_Mm01_00028328 predicted 239
9 SASI_Mm02_00330960 predicted 847
10 SASI_Mm01_00028329 predicted 522
11 SASI_Mm01_00028326 predicted 501
12 SASI_Mm01_00028330 predicted 241
13 SASI_Mm01_00028331 predicted 276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026816
VALIDATED
GTF2F2 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIF, polypeptide 2, 30kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026816.3-588s21c1
Sequence:CCGGTGCTAACCATCAGTACAATATCTCGAGATATTGTACTGATGGTTAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026816.3-694s21c1
Sequence:CCGGGAGAAGCATCAGTACTATAATCTCGAGATTATAGTACTGATGCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026816.1-873s1c1
Sequence:CCGGCGTGTGCTAAAGAGTCAGTCACTCGAGTGACTGACTCTTTAGCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026816.1-578s1c1
Sequence:CCGGGCCTGTTGCTAACCATCAGTACTCGAGTACTGATGGTTAGCAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026816.1-741s1c1
Sequence:CCGGCCTGTGGGATACCTGAAAGAACTCGAGTTCTTTCAGGTATCCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026816.1-547s1c1
Sequence:CCGGAGCTGGACAAAGTTGTAACAACTCGAGTTGTTACAACTTTGTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026816.1-345s1c1
Sequence:CCGGGCTCCTAGAGAACACCCATTTCTCGAGAAATGGGTGTTCTCTAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026816.3-1241s21c1
Sequence:CCGGGGTTAACTTTGCAAGCGTAAACTCGAGTTTACGCTTGCAAAGTTAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026816.3-294s21c1
Sequence:CCGGGAACGAGGATCTTGCAAATATCTCGAGATATTTGCAAGATCCTCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026816.3-349s21c1
Sequence:CCGGGCTCCTAGAGAACACCCATTTCTCGAGAAATGGGTGTTCTCTAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026816
VALIDATED
GTF2F2 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIF, polypeptide 2, 30kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026816.3-588s21c1
Sequence:CCGGTGCTAACCATCAGTACAATATCTCGAGATATTGTACTGATGGTTAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026816.3-694s21c1
Sequence:CCGGGAGAAGCATCAGTACTATAATCTCGAGATTATAGTACTGATGCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026816.1-873s1c1
Sequence:CCGGCGTGTGCTAAAGAGTCAGTCACTCGAGTGACTGACTCTTTAGCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026816.1-578s1c1
Sequence:CCGGGCCTGTTGCTAACCATCAGTACTCGAGTACTGATGGTTAGCAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026816.1-741s1c1
Sequence:CCGGCCTGTGGGATACCTGAAAGAACTCGAGTTCTTTCAGGTATCCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026816.1-547s1c1
Sequence:CCGGAGCTGGACAAAGTTGTAACAACTCGAGTTGTTACAACTTTGTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026816.1-345s1c1
Sequence:CCGGGCTCCTAGAGAACACCCATTTCTCGAGAAATGGGTGTTCTCTAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026816.3-1241s21c1
Sequence:CCGGGGTTAACTTTGCAAGCGTAAACTCGAGTTTACGCTTGCAAAGTTAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026816.3-294s21c1
Sequence:CCGGGAACGAGGATCTTGCAAATATCTCGAGATATTTGCAAGATCCTCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026816.3-349s21c1
Sequence:CCGGGCTCCTAGAGAACACCCATTTCTCGAGAAATGGGTGTTCTCTAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026816
VALIDATED
GTF2F2 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIF, polypeptide 2, 30kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026816.3-588s21c1
Sequence:CCGGTGCTAACCATCAGTACAATATCTCGAGATATTGTACTGATGGTTAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026816.3-694s21c1
Sequence:CCGGGAGAAGCATCAGTACTATAATCTCGAGATTATAGTACTGATGCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026816.1-873s1c1
Sequence:CCGGCGTGTGCTAAAGAGTCAGTCACTCGAGTGACTGACTCTTTAGCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026816.1-578s1c1
Sequence:CCGGGCCTGTTGCTAACCATCAGTACTCGAGTACTGATGGTTAGCAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026816.1-741s1c1
Sequence:CCGGCCTGTGGGATACCTGAAAGAACTCGAGTTCTTTCAGGTATCCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026816.1-547s1c1
Sequence:CCGGAGCTGGACAAAGTTGTAACAACTCGAGTTGTTACAACTTTGTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026816.1-345s1c1
Sequence:CCGGGCTCCTAGAGAACACCCATTTCTCGAGAAATGGGTGTTCTCTAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026816.3-1241s21c1
Sequence:CCGGGGTTAACTTTGCAAGCGTAAACTCGAGTTTACGCTTGCAAAGTTAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026816.3-294s21c1
Sequence:CCGGGAACGAGGATCTTGCAAATATCTCGAGATATTTGCAAGATCCTCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026816.3-349s21c1
Sequence:CCGGGCTCCTAGAGAACACCCATTTCTCGAGAAATGGGTGTTCTCTAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004128
VALIDATED
GTF2F2 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIF, polypeptide 2, 30kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004128.2-456s21c1
Sequence:CCGGGCTCATCAGATAAGCTGTCATCTCGAGATGACAGCTTATCTGATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004128.1-1216s1c1
Sequence:CCGGGCTGAGGTAATACAGATCCAACTCGAGTTGGATCTGTATTACCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004128.1-648s1c1
Sequence:CCGGCGAGCTGATAAACAACATGTTCTCGAGAACATGTTGTTTATCAGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004128.1-415s1c1
Sequence:CCGGGCTCATCAGATAAGCTGTCATCTCGAGATGACAGCTTATCTGATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_004128.1-348s1c1
Sequence:CCGGGCTCCTAGAGAACATCCATTTCTCGAGAAATGGATGTTCTCTAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004128.2-1257s21c1
Sequence:CCGGGCTGAGGTAATACAGATCCAACTCGAGTTGGATCTGTATTACCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004128.2-239s21c1
Sequence:CCGGTTGTCACAGCAATGGGCTAAACTCGAGTTTAGCCCATTGCTGTGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004128.2-689s21c1
Sequence:CCGGCGAGCTGATAAACAACATGTTCTCGAGAACATGTTGTTTATCAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004128.2-389s21c1
Sequence:CCGGGCTCCTAGAGAACATCCATTTCTCGAGAAATGGATGTTCTCTAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004128
VALIDATED
GTF2F2 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIF, polypeptide 2, 30kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004128.2-456s21c1
Sequence:CCGGGCTCATCAGATAAGCTGTCATCTCGAGATGACAGCTTATCTGATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004128.1-1216s1c1
Sequence:CCGGGCTGAGGTAATACAGATCCAACTCGAGTTGGATCTGTATTACCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004128.1-648s1c1
Sequence:CCGGCGAGCTGATAAACAACATGTTCTCGAGAACATGTTGTTTATCAGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004128.1-415s1c1
Sequence:CCGGGCTCATCAGATAAGCTGTCATCTCGAGATGACAGCTTATCTGATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_004128.1-348s1c1
Sequence:CCGGGCTCCTAGAGAACATCCATTTCTCGAGAAATGGATGTTCTCTAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004128.2-1257s21c1
Sequence:CCGGGCTGAGGTAATACAGATCCAACTCGAGTTGGATCTGTATTACCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004128.2-239s21c1
Sequence:CCGGTTGTCACAGCAATGGGCTAAACTCGAGTTTAGCCCATTGCTGTGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004128.2-689s21c1
Sequence:CCGGCGAGCTGATAAACAACATGTTCTCGAGAACATGTTGTTTATCAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004128.2-389s21c1
Sequence:CCGGGCTCCTAGAGAACATCCATTTCTCGAGAAATGGATGTTCTCTAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004128
VALIDATED
GTF2F2 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIF, polypeptide 2, 30kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004128.2-456s21c1
Sequence:CCGGGCTCATCAGATAAGCTGTCATCTCGAGATGACAGCTTATCTGATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004128.1-1216s1c1
Sequence:CCGGGCTGAGGTAATACAGATCCAACTCGAGTTGGATCTGTATTACCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004128.1-648s1c1
Sequence:CCGGCGAGCTGATAAACAACATGTTCTCGAGAACATGTTGTTTATCAGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_004128.1-415s1c1
Sequence:CCGGGCTCATCAGATAAGCTGTCATCTCGAGATGACAGCTTATCTGATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_004128.1-348s1c1
Sequence:CCGGGCTCCTAGAGAACATCCATTTCTCGAGAAATGGATGTTCTCTAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004128.2-1257s21c1
Sequence:CCGGGCTGAGGTAATACAGATCCAACTCGAGTTGGATCTGTATTACCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004128.2-239s21c1
Sequence:CCGGTTGTCACAGCAATGGGCTAAACTCGAGTTTAGCCCATTGCTGTGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004128.2-689s21c1
Sequence:CCGGCGAGCTGATAAACAACATGTTCTCGAGAACATGTTGTTTATCAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004128.2-389s21c1
Sequence:CCGGGCTCCTAGAGAACATCCATTTCTCGAGAAATGGATGTTCTCTAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)