EMAIL THIS PAGE TO A FRIEND

GTF2H1

general transcription factor IIH, polypeptide 1, 62kDa

152 Gene Product Result for
Synonyms: BTF2 P62 TFB1 TFIIH
UniProtKB ID: P32780, D3DQY2, Q6I9Y7, Q9H5K5, Q9NQD9
Gene ID:
Mouse(14884) general transcription factor II H, polypeptide 1
Rat(361580) general transcription factor IIH, polypeptide 1
Zebrafish(447857) general transcription factor II H, polypeptide 1
chicken(423081) general transcription factor IIH, polypeptide 1, 62kDa
domestic cat(101100000) general transcription factor IIH, polypeptide 1, 62kDa
cow(513510) general transcription factor IIH, polypeptide 1, 62kDa
Horse(100056980) general transcription factor IIH, polypeptide 1, 62kDa
dog(476881) general transcription factor IIH, polypeptide 1, 62kDa
domestic guinea pig(100714157) general transcription factor IIH, polypeptide 1, 62kDa
naked mole-rat(101713708) general transcription factor IIH, polypeptide 1, 62kDa
sheep(101119683) general transcription factor IIH, polypeptide 1, 62kDa
Domestic Rabbit(100342919) general transcription factor IIH, polypeptide 1, 62kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501337 Anti-CD153 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
GW22005A Anti-GTF2H1 (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, mouse, human
western blot pricing
GW22005B Anti-GTF2H1 (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
AV100811 Anti-GTF2H1 antibody produced in rabbit IgG fraction of antiserum guinea pig, mouse, human, horse, rat, zebrafish
immunohistochemistry, western blot pricing
HPA046660 Anti-GTF2H1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104463 Anti-GTF2H1 antibody produced in rabbit affinity isolated antibody horse, canine, bovine, mouse, human, rat, guinea pig, zebrafish
western blot pricing
SAB4501336 Anti-TF2H1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing
WH0002965M1 Monoclonal Anti-GTF2H1 antibody produced in mouse clone 1F12-1B5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403894 Monoclonal Anti-GTF2H1, (C-terminal) antibody produced in mouse clone 4B9, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005316 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005316 Rosetta Predictions human pricing
NM_001108485 Rosetta Predictions rat pricing
NM_008186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167488 predicted 608
2 SASI_Hs01_00167489 predicted 1324
3 SASI_Hs01_00167491 predicted 373
4 SASI_Hs02_00339384 predicted 710
5 SASI_Hs01_00167492 predicted 573
6 SASI_Hs01_00167493 predicted 805
7 SASI_Hs01_00167495 predicted 1515
8 SASI_Hs02_00339385 predicted 1561
9 SASI_Hs01_00167497 predicted 726
10 SASI_Hs02_00339386 predicted 1468
11 SASI_Hs01_00167490 predicted 875
12 SASI_Hs01_00167494 predicted 1027
13 SASI_Hs01_00167496 predicted 1381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108485 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239109 predicted 1258
2 SASI_Rn02_00239110 predicted 1381
3 SASI_Rn02_00239111 predicted 1238
4 SASI_Rn02_00239112 predicted 890
5 SASI_Rn02_00239113 predicted 749
6 SASI_Rn02_00239114 predicted 1368
7 SASI_Rn02_00239115 predicted 770
8 SASI_Rn02_00239116 predicted 622
9 SASI_Rn02_00239117 predicted 1333
10 SASI_Rn02_00239118 predicted 1416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180925 predicted 1366
2 SASI_Mm01_00180926 predicted 1063
3 SASI_Mm01_00180927 predicted 1423
4 SASI_Mm01_00180929 predicted 1564
5 SASI_Mm01_00180930 predicted 1389
6 SASI_Mm01_00180931 predicted 628
7 SASI_Mm01_00180932 predicted 777
8 SASI_Mm02_00313330 predicted 826
9 SASI_Mm01_00180933 predicted 1338
10 SASI_Mm01_00180934 predicted 477
11 SASI_Mm01_00180928 predicted 753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008186
VALIDATED
GTF2H1 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIH, polypeptide 1, 62kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008186.2-2371s1c1
Sequence:CCGGGCATGTTAAAGAGAGTGCTTTCTCGAGAAAGCACTCTCTTTAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008186.2-898s1c1
Sequence:CCGGCCGACTAAATACAGGATCGAACTCGAGTTCGATCCTGTATTTAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008186.2-632s1c1
Sequence:CCGGGCCAATCGTTTAAATGTGAATCTCGAGATTCACATTTAAACGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008186.2-1637s1c1
Sequence:CCGGCCTGTTAATACACCATTCCTACTCGAGTAGGAATGGTGTATTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008186.4-1844s21c1
Sequence:CCGGAGAAGACGTGAAGCGTTTATGCTCGAGCATAAACGCTTCACGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008186.4-2079s21c1
Sequence:CCGGATGAGCTAAGTTGCAAATATACTCGAGTATATTTGCAACTTAGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008186.4-640s21c1
Sequence:CCGGGCCAATCGTTTAAATGTGAATCTCGAGATTCACATTTAAACGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008186.4-1558s21c1
Sequence:CCGGCAGATGGTGCCAAACGATATTCTCGAGAATATCGTTTGGCACCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008186.4-1037s21c1
Sequence:CCGGTAGACGAGGGCTATGGCATTTCTCGAGAAATGCCATAGCCCTCGTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008186
VALIDATED
GTF2H1 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIH, polypeptide 1, 62kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008186.2-2371s1c1
Sequence:CCGGGCATGTTAAAGAGAGTGCTTTCTCGAGAAAGCACTCTCTTTAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008186.2-898s1c1
Sequence:CCGGCCGACTAAATACAGGATCGAACTCGAGTTCGATCCTGTATTTAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008186.2-632s1c1
Sequence:CCGGGCCAATCGTTTAAATGTGAATCTCGAGATTCACATTTAAACGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008186.2-1637s1c1
Sequence:CCGGCCTGTTAATACACCATTCCTACTCGAGTAGGAATGGTGTATTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008186.4-1844s21c1
Sequence:CCGGAGAAGACGTGAAGCGTTTATGCTCGAGCATAAACGCTTCACGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008186.4-2079s21c1
Sequence:CCGGATGAGCTAAGTTGCAAATATACTCGAGTATATTTGCAACTTAGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008186.4-640s21c1
Sequence:CCGGGCCAATCGTTTAAATGTGAATCTCGAGATTCACATTTAAACGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008186.4-1558s21c1
Sequence:CCGGCAGATGGTGCCAAACGATATTCTCGAGAATATCGTTTGGCACCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008186.4-1037s21c1
Sequence:CCGGTAGACGAGGGCTATGGCATTTCTCGAGAAATGCCATAGCCCTCGTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008186
VALIDATED
GTF2H1 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIH, polypeptide 1, 62kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008186.2-2371s1c1
Sequence:CCGGGCATGTTAAAGAGAGTGCTTTCTCGAGAAAGCACTCTCTTTAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008186.2-898s1c1
Sequence:CCGGCCGACTAAATACAGGATCGAACTCGAGTTCGATCCTGTATTTAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008186.2-632s1c1
Sequence:CCGGGCCAATCGTTTAAATGTGAATCTCGAGATTCACATTTAAACGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008186.2-1637s1c1
Sequence:CCGGCCTGTTAATACACCATTCCTACTCGAGTAGGAATGGTGTATTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008186.4-1844s21c1
Sequence:CCGGAGAAGACGTGAAGCGTTTATGCTCGAGCATAAACGCTTCACGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295596    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008186.4-2079s21c1
Sequence:CCGGATGAGCTAAGTTGCAAATATACTCGAGTATATTTGCAACTTAGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008186.4-640s21c1
Sequence:CCGGGCCAATCGTTTAAATGTGAATCTCGAGATTCACATTTAAACGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008186.4-1558s21c1
Sequence:CCGGCAGATGGTGCCAAACGATATTCTCGAGAATATCGTTTGGCACCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008186.4-1037s21c1
Sequence:CCGGTAGACGAGGGCTATGGCATTTCTCGAGAAATGCCATAGCCCTCGTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005316
VALIDATED
GTF2H1 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIH, polypeptide 1, 62kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005316.2-2502s1c1
Sequence:CCGGCCTGAATAATAAAGAGGGAATCTCGAGATTCCCTCTTTATTATTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005316.2-1061s1c1
Sequence:CCGGGCTGCCATCATCAAGAGATTTCTCGAGAAATCTCTTGATGATGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005316.2-1316s1c1
Sequence:CCGGCCAACTCCAATCCAGTCACTACTCGAGTAGTGACTGGATTGGAGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005316.2-1228s1c1
Sequence:CCGGGTCCATTGAATATGAAGACTTCTCGAGAAGTCTTCATATTCAATGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005316.2-1755s1c1
Sequence:CCGGCCTACAACAAGCTCCACACATCTCGAGATGTGTGGAGCTTGTTGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005316.3-1388s21c1
Sequence:CCGGGCTGCCATCATCAAGAGATTTCTCGAGAAATCTCTTGATGATGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005316.3-2082s21c1
Sequence:CCGGCCTACAACAAGCTCCACACATCTCGAGATGTGTGGAGCTTGTTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005316.3-1058s21c1
Sequence:CCGGGATATCATTGAGTCCATATTTCTCGAGAAATATGGACTCAATGATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005316.3-910s21c1
Sequence:CCGGATTCTGGGCCAATCGTTTAAACTCGAGTTTAAACGATTGGCCCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005316.3-2221s21c1
Sequence:CCGGATGACCTCACAGGAGTGATAACTCGAGTTATCACTCCTGTGAGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005316
VALIDATED
GTF2H1 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIH, polypeptide 1, 62kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005316.2-2502s1c1
Sequence:CCGGCCTGAATAATAAAGAGGGAATCTCGAGATTCCCTCTTTATTATTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005316.2-1061s1c1
Sequence:CCGGGCTGCCATCATCAAGAGATTTCTCGAGAAATCTCTTGATGATGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005316.2-1316s1c1
Sequence:CCGGCCAACTCCAATCCAGTCACTACTCGAGTAGTGACTGGATTGGAGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005316.2-1228s1c1
Sequence:CCGGGTCCATTGAATATGAAGACTTCTCGAGAAGTCTTCATATTCAATGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005316.2-1755s1c1
Sequence:CCGGCCTACAACAAGCTCCACACATCTCGAGATGTGTGGAGCTTGTTGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005316.3-1388s21c1
Sequence:CCGGGCTGCCATCATCAAGAGATTTCTCGAGAAATCTCTTGATGATGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005316.3-2082s21c1
Sequence:CCGGCCTACAACAAGCTCCACACATCTCGAGATGTGTGGAGCTTGTTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005316.3-1058s21c1
Sequence:CCGGGATATCATTGAGTCCATATTTCTCGAGAAATATGGACTCAATGATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005316.3-910s21c1
Sequence:CCGGATTCTGGGCCAATCGTTTAAACTCGAGTTTAAACGATTGGCCCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005316.3-2221s21c1
Sequence:CCGGATGACCTCACAGGAGTGATAACTCGAGTTATCACTCCTGTGAGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005316
VALIDATED
GTF2H1 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIH, polypeptide 1, 62kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005316.2-2502s1c1
Sequence:CCGGCCTGAATAATAAAGAGGGAATCTCGAGATTCCCTCTTTATTATTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005316.2-1061s1c1
Sequence:CCGGGCTGCCATCATCAAGAGATTTCTCGAGAAATCTCTTGATGATGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005316.2-1316s1c1
Sequence:CCGGCCAACTCCAATCCAGTCACTACTCGAGTAGTGACTGGATTGGAGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005316.2-1228s1c1
Sequence:CCGGGTCCATTGAATATGAAGACTTCTCGAGAAGTCTTCATATTCAATGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005316.2-1755s1c1
Sequence:CCGGCCTACAACAAGCTCCACACATCTCGAGATGTGTGGAGCTTGTTGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005316.3-1388s21c1
Sequence:CCGGGCTGCCATCATCAAGAGATTTCTCGAGAAATCTCTTGATGATGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005316.3-2082s21c1
Sequence:CCGGCCTACAACAAGCTCCACACATCTCGAGATGTGTGGAGCTTGTTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005316.3-1058s21c1
Sequence:CCGGGATATCATTGAGTCCATATTTCTCGAGAAATATGGACTCAATGATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005316.3-910s21c1
Sequence:CCGGATTCTGGGCCAATCGTTTAAACTCGAGTTTAAACGATTGGCCCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315381    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005316.3-2221s21c1
Sequence:CCGGATGACCTCACAGGAGTGATAACTCGAGTTATCACTCCTGTGAGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)