EMAIL THIS PAGE TO A FRIEND

GTF2H2

general transcription factor IIH, polypeptide 2, 44kDa

87 Gene Product Result for
Synonyms: BTF2 BTF2P44 T-BTF2P44 TFIIH p44
UniProtKB ID: Q13888, Q15570, Q15571, Q9BS41
Gene ID:
Human(2966) Summary: This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This gene is within the telomeric copy of the duplication. Deletion of this gene sometimes accompanies deletion of the neighboring SMN1 gene in spinal muscular atrophy (SMA) patients but it is unclear if deletion of this gene contributes to the SMA phenotype. This gene encodes the 44 kDa subunit of RNA polymerase II transcription initiation factor IIH which is involved in basal transcription and nucleotide excision repair. Transcript variants for this gene have been described, but their full length nature has not been determined. A second copy of this gene within the centromeric copy of the duplication has been described in the literature. It is reported to be different by either two or four base pairs; however, no sequence data is currently available for the centromeric copy of the gene. [provided by RefSeq, Jul 2008]
Mouse(23894) general transcription factor II H, polypeptide 2
Rat(294693) general transcription factor IIH, polypeptide 2
sheep(101118051) general transcription factor IIH, polypeptide 2, 44kDa
domestic guinea pig(100733552) general transcription factor IIH, polypeptide 2, 44kDa
naked mole-rat(101705678) general transcription factor IIH, polypeptide 2, 44kDa
Zebrafish(323239) general transcription factor IIH, polypeptide 2
Thale Cress(839332) transcription initiation factor TFIIH subunit H2
chicken(100858972) general transcription factor IIH, polypeptide 2, 44kDa
cow(511829) general transcription factor IIH, polypeptide 2, 44kDa
Horse(100073305) general transcription factor IIH, polypeptide 2, 44kDa
domestic cat(101094730) general transcription factor IIH, polypeptide 2, 44kDa
dog(478089) general transcription factor IIH, polypeptide 2, 44kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001515 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001515 Rosetta Predictions human pricing
NM_001077428 Rosetta Predictions rat pricing
NM_022011 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332025 predicted 255
2 SASI_Hs02_00332026 predicted 434
3 SASI_Hs01_00220923 predicted 372
4 SASI_Hs02_00332027 predicted 277
5 SASI_Hs02_00332028 predicted 291
6 SASI_Hs02_00332029 predicted 361
7 SASI_Hs02_00332030 predicted 421
8 SASI_Hs02_00332031 predicted 304
9 SASI_Hs01_00220930 predicted 356
10 SASI_Hs02_00332032 predicted 278
11 SASI_Hs01_00220922 predicted 733
12 SASI_Hs01_00220924 predicted 777
13 SASI_Hs01_00220925 predicted 939
14 SASI_Hs01_00220926 predicted 996
15 SASI_Hs01_00220927 predicted 776
16 SASI_Hs01_00220928 predicted 1002
17 SASI_Hs01_00220929 predicted 1043
18 SASI_Hs01_00220931 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077428 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207522 predicted 745
2 SASI_Rn02_00207523 predicted 711
3 SASI_Rn02_00207524 predicted 315
4 SASI_Rn02_00207525 predicted 914
5 SASI_Rn02_00207526 predicted 553
6 SASI_Rn02_00207527 predicted 486
7 SASI_Rn02_00207528 predicted 1128
8 SASI_Rn02_00207529 predicted 360
9 SASI_Rn02_00207530 predicted 484
10 SASI_Rn02_00207531 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140059 predicted 790
2 SASI_Mm02_00326483 predicted 671
3 SASI_Mm01_00140060 predicted 817
4 SASI_Mm01_00140061 predicted 454
5 SASI_Mm01_00140062 predicted 371
6 SASI_Mm01_00140063 predicted 576
7 SASI_Mm01_00140065 predicted 774
8 SASI_Mm01_00140066 predicted 359
9 SASI_Mm01_00140067 predicted 675
10 SASI_Mm01_00140068 predicted 1148
11 SASI_Mm01_00140064 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001515
GTF2H2 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIH, polypeptide 2, 44kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001515.3-697s21c1
Sequence:CCGGACAAGTCGAGAAGTACTAATCCTCGAGGATTAGTACTTCTCGACTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001515.3-1396s21c1
Sequence:CCGGTGATTCCAGCATGTAGTATACCTCGAGGTATACTACATGCTGGAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001515.3-1108s21c1
Sequence:CCGGGAGCTACCTGTTGAGTGTAAACTCGAGTTTACACTCAACAGGTAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001515.3-660s21c1
Sequence:CCGGCATAGCTATGCAGACTCTAAACTCGAGTTTAGAGTCTGCATAGCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001515.2-1547s1c1
Sequence:CCGGGTCACAGAAATACCTGAAATTCTCGAGAATTTCAGGTATTTCTGTGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001515.2-370s1c1
Sequence:CCGGCGCCACCTTTATGTGGTAGTACTCGAGTACTACCACATAAAGGTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001515.2-1342s1c1
Sequence:CCGGCCTGGCTGTATTCATAAGATTCTCGAGAATCTTATGAATACAGCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001515.2-935s1c1
Sequence:CCGGGCTCACTTATTCGTATGGGATCTCGAGATCCCATACGAATAAGTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001515.2-493s1c1
Sequence:CCGGCCTATTAGTCAGATTGGAATACTCGAGTATTCCAATCTGACTAATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001515
GTF2H2 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIH, polypeptide 2, 44kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001515.3-697s21c1
Sequence:CCGGACAAGTCGAGAAGTACTAATCCTCGAGGATTAGTACTTCTCGACTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001515.3-1396s21c1
Sequence:CCGGTGATTCCAGCATGTAGTATACCTCGAGGTATACTACATGCTGGAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001515.3-1108s21c1
Sequence:CCGGGAGCTACCTGTTGAGTGTAAACTCGAGTTTACACTCAACAGGTAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001515.3-660s21c1
Sequence:CCGGCATAGCTATGCAGACTCTAAACTCGAGTTTAGAGTCTGCATAGCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001515.2-1547s1c1
Sequence:CCGGGTCACAGAAATACCTGAAATTCTCGAGAATTTCAGGTATTTCTGTGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001515.2-370s1c1
Sequence:CCGGCGCCACCTTTATGTGGTAGTACTCGAGTACTACCACATAAAGGTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001515.2-1342s1c1
Sequence:CCGGCCTGGCTGTATTCATAAGATTCTCGAGAATCTTATGAATACAGCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001515.2-935s1c1
Sequence:CCGGGCTCACTTATTCGTATGGGATCTCGAGATCCCATACGAATAAGTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001515.2-493s1c1
Sequence:CCGGCCTATTAGTCAGATTGGAATACTCGAGTATTCCAATCTGACTAATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001515
GTF2H2 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIH, polypeptide 2, 44kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001515.3-697s21c1
Sequence:CCGGACAAGTCGAGAAGTACTAATCCTCGAGGATTAGTACTTCTCGACTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001515.3-1396s21c1
Sequence:CCGGTGATTCCAGCATGTAGTATACCTCGAGGTATACTACATGCTGGAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001515.3-1108s21c1
Sequence:CCGGGAGCTACCTGTTGAGTGTAAACTCGAGTTTACACTCAACAGGTAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001515.3-660s21c1
Sequence:CCGGCATAGCTATGCAGACTCTAAACTCGAGTTTAGAGTCTGCATAGCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020964    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001515.2-1547s1c1
Sequence:CCGGGTCACAGAAATACCTGAAATTCTCGAGAATTTCAGGTATTTCTGTGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001515.2-370s1c1
Sequence:CCGGCGCCACCTTTATGTGGTAGTACTCGAGTACTACCACATAAAGGTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001515.2-1342s1c1
Sequence:CCGGCCTGGCTGTATTCATAAGATTCTCGAGAATCTTATGAATACAGCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001515.2-935s1c1
Sequence:CCGGGCTCACTTATTCGTATGGGATCTCGAGATCCCATACGAATAAGTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001515.2-493s1c1
Sequence:CCGGCCTATTAGTCAGATTGGAATACTCGAGTATTCCAATCTGACTAATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022011
VALIDATED
GTF2H2 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIH, polypeptide 2, 44kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022011.4-1484s21c1
Sequence:CCGGGAAAGCACTTTGAAAGAAGATCTCGAGATCTTCTTTCAAAGTGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022011.4-614s21c1
Sequence:CCGGCATCGCTCTATAATTCCTTAACTCGAGTTAAGGAATTATAGAGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022011.4-551s21c1
Sequence:CCGGGAAACCCAAGGAAACATATAACTCGAGTTATATGTTTCCTTGGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022011.4-712s21c1
Sequence:CCGGACCTGTGATCCATCTAATATTCTCGAGAATATTAGATGGATCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022011.4-268s21c1
Sequence:CCGGGGATCACTTAAAGCTACAATACTCGAGTATTGTAGCTTTAAGTGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022011.2-578s1c1
Sequence:CCGGCATCGCTCTATAATTCCTTAACTCGAGTTAAGGAATTATAGAGCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022011.2-1304s1c1
Sequence:CCGGGCTGTATTCATAAGATCCCAACTCGAGTTGGGATCTTATGAATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022011.2-1448s1c1
Sequence:CCGGGAAAGCACTTTGAAAGAAGATCTCGAGATCTTCTTTCAAAGTGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022011.2-577s1c1
Sequence:CCGGCCATCGCTCTATAATTCCTTACTCGAGTAAGGAATTATAGAGCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022011.2-1320s1c1
Sequence:CCGGCCCAACTCCTTCAGGTATTTACTCGAGTAAATACCTGAAGGAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022011
VALIDATED
GTF2H2 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIH, polypeptide 2, 44kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022011.4-1484s21c1
Sequence:CCGGGAAAGCACTTTGAAAGAAGATCTCGAGATCTTCTTTCAAAGTGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022011.4-614s21c1
Sequence:CCGGCATCGCTCTATAATTCCTTAACTCGAGTTAAGGAATTATAGAGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022011.4-551s21c1
Sequence:CCGGGAAACCCAAGGAAACATATAACTCGAGTTATATGTTTCCTTGGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022011.4-712s21c1
Sequence:CCGGACCTGTGATCCATCTAATATTCTCGAGAATATTAGATGGATCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022011.4-268s21c1
Sequence:CCGGGGATCACTTAAAGCTACAATACTCGAGTATTGTAGCTTTAAGTGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022011.2-578s1c1
Sequence:CCGGCATCGCTCTATAATTCCTTAACTCGAGTTAAGGAATTATAGAGCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022011.2-1304s1c1
Sequence:CCGGGCTGTATTCATAAGATCCCAACTCGAGTTGGGATCTTATGAATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022011.2-1448s1c1
Sequence:CCGGGAAAGCACTTTGAAAGAAGATCTCGAGATCTTCTTTCAAAGTGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022011.2-577s1c1
Sequence:CCGGCCATCGCTCTATAATTCCTTACTCGAGTAAGGAATTATAGAGCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022011.2-1320s1c1
Sequence:CCGGCCCAACTCCTTCAGGTATTTACTCGAGTAAATACCTGAAGGAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022011
VALIDATED
GTF2H2 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIH, polypeptide 2, 44kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022011.4-1484s21c1
Sequence:CCGGGAAAGCACTTTGAAAGAAGATCTCGAGATCTTCTTTCAAAGTGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022011.4-614s21c1
Sequence:CCGGCATCGCTCTATAATTCCTTAACTCGAGTTAAGGAATTATAGAGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022011.4-551s21c1
Sequence:CCGGGAAACCCAAGGAAACATATAACTCGAGTTATATGTTTCCTTGGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022011.4-712s21c1
Sequence:CCGGACCTGTGATCCATCTAATATTCTCGAGAATATTAGATGGATCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_022011.4-268s21c1
Sequence:CCGGGGATCACTTAAAGCTACAATACTCGAGTATTGTAGCTTTAAGTGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022011.2-578s1c1
Sequence:CCGGCATCGCTCTATAATTCCTTAACTCGAGTTAAGGAATTATAGAGCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022011.2-1304s1c1
Sequence:CCGGGCTGTATTCATAAGATCCCAACTCGAGTTGGGATCTTATGAATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022011.2-1448s1c1
Sequence:CCGGGAAAGCACTTTGAAAGAAGATCTCGAGATCTTCTTTCAAAGTGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022011.2-577s1c1
Sequence:CCGGCCATCGCTCTATAATTCCTTACTCGAGTAAGGAATTATAGAGCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022011.2-1320s1c1
Sequence:CCGGCCCAACTCCTTCAGGTATTTACTCGAGTAAATACCTGAAGGAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)