EMAIL THIS PAGE TO A FRIEND

GTF2H2B

general transcription factor IIH, polypeptide 2B (pseudogene)

242 Gene Product Result for
Species: Human GTF2H2B(653238)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098729 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098729 Rosetta Predictions human pricing
XM_927919 Rosetta Predictions human pricing
XM_932365 Rosetta Predictions human pricing
XM_932369 Rosetta Predictions human pricing
XM_932373 Rosetta Predictions human pricing
XM_932376 Rosetta Predictions human pricing
XM_932379 Rosetta Predictions human pricing
XM_932384 Rosetta Predictions human pricing
XM_932389 Rosetta Predictions human pricing
XM_932394 Rosetta Predictions human pricing
XM_932399 Rosetta Predictions human pricing
XM_932404 Rosetta Predictions human pricing
XM_932410 Rosetta Predictions human pricing
XM_932421 Rosetta Predictions human pricing
XM_932426 Rosetta Predictions human pricing
XM_932433 Rosetta Predictions human pricing
XM_932437 Rosetta Predictions human pricing
XM_932441 Rosetta Predictions human pricing
XM_932446 Rosetta Predictions human pricing
XM_932452 Rosetta Predictions human pricing
XM_932459 Rosetta Predictions human pricing
XM_932465 Rosetta Predictions human pricing
XM_932469 Rosetta Predictions human pricing
XM_932474 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319779 predicted 243
2 SASI_Hs02_00319780 predicted 426
3 SASI_Hs02_00319781 predicted 360
4 SASI_Hs02_00319782 predicted 258
5 SASI_Hs02_00319783 predicted 272
6 SASI_Hs02_00319784 predicted 348
7 SASI_Hs02_00319785 predicted 410
8 SASI_Hs02_00319786 predicted 286
9 SASI_Hs02_00319787 predicted 341
10 SASI_Hs02_00319788 predicted 268
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279672 predicted 437
2 SASI_Hs01_00279673 predicted 742
3 SASI_Hs01_00279674 predicted 374
4 SASI_Hs01_00279675 predicted 283
5 SASI_Hs01_00279676 predicted 795
6 SASI_Hs01_00279677 predicted 955
7 SASI_Hs01_00279678 predicted 1009
8 SASI_Hs01_00279679 predicted 510
9 SASI_Hs01_00279680 predicted 296
10 SASI_Hs01_00279681 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932365 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279891 predicted 973
2 SASI_Hs01_00279892 predicted 974
3 SASI_Hs01_00279893 predicted 967
4 SASI_Hs01_00279894 predicted 977
5 SASI_Hs01_00279895 predicted 977
6 SASI_Hs01_00279896 predicted 913
7 SASI_Hs01_00279897 predicted 1098
8 SASI_Hs01_00279898 predicted 1987
9 SASI_Hs01_00279899 predicted 1139
10 SASI_Hs01_00279900 predicted 1232
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284429 predicted 349
2 SASI_Hs01_00284430 predicted 283
3 SASI_Hs01_00284431 predicted 469
4 SASI_Hs01_00284432 predicted 415
5 SASI_Hs01_00284433 predicted 375
6 SASI_Hs01_00284434 predicted 269
7 SASI_Hs01_00284435 predicted 328
8 SASI_Hs01_00284436 predicted 212
9 SASI_Hs01_00284437 predicted 268
10 SASI_Hs01_00284438 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276654 predicted 198
2 SASI_Hs01_00276655 predicted 314
3 SASI_Hs01_00276656 predicted 212
4 SASI_Hs01_00276657 predicted 337
5 SASI_Hs01_00276658 predicted 225
6 SASI_Hs01_00276659 predicted 310
7 SASI_Hs01_00276660 predicted 367
8 SASI_Hs01_00276661 predicted 246
9 SASI_Hs01_00276662 predicted 299
10 SASI_Hs01_00276663 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00253877 predicted 256
2 SASI_Hs01_00253878 predicted 435
3 SASI_Hs01_00253879 predicted 371
4 SASI_Hs01_00253880 predicted 559
5 SASI_Hs01_00253881 predicted 282
6 SASI_Hs01_00253882 predicted 510
7 SASI_Hs01_00253883 predicted 466
8 SASI_Hs01_00253884 predicted 288
9 SASI_Hs01_00253885 predicted 364
10 SASI_Hs01_00253886 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280822 predicted 487
2 SASI_Hs01_00280823 predicted 227
3 SASI_Hs01_00280824 predicted 540
4 SASI_Hs01_00280825 predicted 305
5 SASI_Hs01_00280826 predicted 535
6 SASI_Hs01_00280827 predicted 296
7 SASI_Hs01_00280828 predicted 219
8 SASI_Hs01_00280829 predicted 282
9 SASI_Hs01_00280830 predicted 443
10 SASI_Hs01_00280831 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291144 predicted 262
2 SASI_Hs01_00291145 predicted 281
3 SASI_Hs01_00291146 predicted 289
4 SASI_Hs01_00291147 predicted 301
5 SASI_Hs01_00291148 predicted 235
6 SASI_Hs01_00291149 predicted 307
7 SASI_Hs01_00291150 predicted 369
8 SASI_Hs01_00291151 predicted 289
9 SASI_Hs01_00291152 predicted 365
10 SASI_Hs01_00291153 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269400 predicted 256
2 SASI_Hs01_00269401 predicted 368
3 SASI_Hs01_00269402 predicted 285
4 SASI_Hs01_00269403 predicted 394
5 SASI_Hs01_00269404 predicted 296
6 SASI_Hs01_00269405 predicted 366
7 SASI_Hs01_00269406 predicted 303
8 SASI_Hs01_00269407 predicted 359
9 SASI_Hs01_00269408 predicted 287
10 SASI_Hs01_00269409 predicted 401
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256225 predicted 388
2 SASI_Hs01_00256226 predicted 551
3 SASI_Hs01_00256227 predicted 512
4 SASI_Hs01_00256228 predicted 469
5 SASI_Hs01_00256229 predicted 419
6 SASI_Hs01_00256230 predicted 344
7 SASI_Hs01_00256231 predicted 380
8 SASI_Hs01_00256232 predicted 393
9 SASI_Hs01_00256233 predicted 366
10 SASI_Hs01_00256234 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260273 predicted 441
2 SASI_Hs01_00260274 predicted 377
3 SASI_Hs01_00260275 predicted 278
4 SASI_Hs01_00260276 predicted 508
5 SASI_Hs01_00260277 predicted 295
6 SASI_Hs01_00260278 predicted 421
7 SASI_Hs01_00260279 predicted 310
8 SASI_Hs01_00260280 predicted 358
9 SASI_Hs01_00260281 predicted 433
10 SASI_Hs01_00260282 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288853 predicted 347
2 SASI_Hs01_00288854 predicted 277
3 SASI_Hs01_00288855 predicted 466
4 SASI_Hs01_00288856 predicted 416
5 SASI_Hs01_00288857 predicted 372
6 SASI_Hs01_00288858 predicted 271
7 SASI_Hs01_00288859 predicted 330
8 SASI_Hs01_00288860 predicted 205
9 SASI_Hs01_00288861 predicted 269
10 SASI_Hs01_00288862 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296913 predicted 442
2 SASI_Hs01_00296914 predicted 742
3 SASI_Hs01_00296915 predicted 275
4 SASI_Hs01_00296916 predicted 1010
5 SASI_Hs01_00296917 predicted 516
6 SASI_Hs01_00296918 predicted 295
7 SASI_Hs01_00296919 predicted 422
8 SASI_Hs01_00296920 predicted 300
9 SASI_Hs01_00296921 predicted 1056
10 SASI_Hs01_00296922 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276162 predicted 261
2 SASI_Hs01_00276163 predicted 436
3 SASI_Hs01_00276164 predicted 368
4 SASI_Hs01_00276165 predicted 557
5 SASI_Hs01_00276166 predicted 282
6 SASI_Hs01_00276167 predicted 687
7 SASI_Hs01_00276168 predicted 510
8 SASI_Hs01_00276169 predicted 294
9 SASI_Hs01_00276170 predicted 371
10 SASI_Hs01_00276171 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265545 predicted 441
2 SASI_Hs01_00265546 predicted 746
3 SASI_Hs01_00265547 predicted 368
4 SASI_Hs01_00265548 predicted 277
5 SASI_Hs01_00265549 predicted 788
6 SASI_Hs01_00265550 predicted 947
7 SASI_Hs01_00265551 predicted 1016
8 SASI_Hs01_00265552 predicted 507
9 SASI_Hs01_00265553 predicted 296
10 SASI_Hs01_00265554 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295365 predicted 1484
2 SASI_Hs01_00295366 predicted 1291
3 SASI_Hs01_00295367 predicted 1294
4 SASI_Hs01_00295368 predicted 1298
5 SASI_Hs01_00295369 predicted 1383
6 SASI_Hs01_00295370 predicted 1302
7 SASI_Hs01_00295371 predicted 1315
8 SASI_Hs01_00295372 predicted 1383
9 SASI_Hs01_00295373 predicted 1274
10 SASI_Hs01_00295374 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268141 predicted 881
2 SASI_Hs01_00268142 predicted 1035
3 SASI_Hs01_00268143 predicted 1357
4 SASI_Hs01_00268144 predicted 1102
5 SASI_Hs01_00268145 predicted 1149
6 SASI_Hs01_00268146 predicted 877
7 SASI_Hs01_00268147 predicted 1172
8 SASI_Hs01_00268148 predicted 1172
9 SASI_Hs01_00268149 predicted 1102
10 SASI_Hs01_00268150 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254676 predicted 437
2 SASI_Hs01_00254677 predicted 741
3 SASI_Hs01_00254678 predicted 376
4 SASI_Hs01_00254679 predicted 275
5 SASI_Hs01_00254680 predicted 787
6 SASI_Hs01_00254681 predicted 973
7 SASI_Hs01_00254682 predicted 511
8 SASI_Hs01_00254683 predicted 289
9 SASI_Hs01_00254684 predicted 428
10 SASI_Hs01_00254685 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00277676 predicted 352
2 SASI_Hs01_00277677 predicted 604
3 SASI_Hs01_00277678 predicted 429
4 SASI_Hs01_00277679 predicted 654
5 SASI_Hs01_00277680 predicted 816
6 SASI_Hs01_00277681 predicted 875
7 SASI_Hs01_00277682 predicted 659
8 SASI_Hs01_00277683 predicted 885
9 SASI_Hs01_00277684 predicted 343
10 SASI_Hs01_00277685 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293898 predicted 319
2 SASI_Hs01_00293899 predicted 630
3 SASI_Hs01_00293900 predicted 677
4 SASI_Hs01_00293901 predicted 832
5 SASI_Hs01_00293902 predicted 902
6 SASI_Hs01_00293903 predicted 393
7 SASI_Hs01_00293904 predicted 898
8 SASI_Hs01_00293905 predicted 306
9 SASI_Hs01_00293906 predicted 939
10 SASI_Hs01_00293907 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293221 predicted 444
2 SASI_Hs01_00293222 predicted 697
3 SASI_Hs01_00293223 predicted 376
4 SASI_Hs01_00293224 predicted 279
5 SASI_Hs01_00293225 predicted 739
6 SASI_Hs01_00293226 predicted 897
7 SASI_Hs01_00293227 predicted 957
8 SASI_Hs01_00293228 predicted 296
9 SASI_Hs01_00293229 predicted 431
10 SASI_Hs01_00293230 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270917 predicted 372
2 SASI_Hs01_00270918 predicted 680
3 SASI_Hs01_00270919 predicted 732
4 SASI_Hs01_00270920 predicted 885
5 SASI_Hs01_00270921 predicted 946
6 SASI_Hs01_00270922 predicted 455
7 SASI_Hs01_00270923 predicted 951
8 SASI_Hs01_00270924 predicted 361
9 SASI_Hs01_00270925 predicted 990
10 SASI_Hs01_00270926 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299666 predicted 339
2 SASI_Hs01_00299667 predicted 645
3 SASI_Hs01_00299668 predicted 276
4 SASI_Hs01_00299669 predicted 464
5 SASI_Hs01_00299670 predicted 699
6 SASI_Hs01_00299671 predicted 856
7 SASI_Hs01_00299672 predicted 914
8 SASI_Hs01_00299673 predicted 416
9 SASI_Hs01_00299674 predicted 327
10 SASI_Hs01_00299675 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260617 predicted 525
2 SASI_Hs01_00260618 predicted 825
3 SASI_Hs01_00260619 predicted 881
4 SASI_Hs01_00260620 predicted 1033
5 SASI_Hs01_00260621 predicted 1105
6 SASI_Hs01_00260622 predicted 596
7 SASI_Hs01_00260623 predicted 1106
8 SASI_Hs01_00260624 predicted 510
9 SASI_Hs01_00260625 predicted 1147
10 SASI_Hs01_00260626 predicted 529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098729
VALIDATED
GTF2H2B MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIH, polypeptide 2B (pseudogene)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000255677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098729.1-723s21c1
Sequence:CCGGTTGCGATCCATCTAATATTTACTCGAGTAAATATTAGATGGATCGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098729.1-1447s21c1
Sequence:CCGGTCTTTAGAAGAAGCTTCATTTCTCGAGAAATGAAGCTTCTTCTAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098729.1-681s21c1
Sequence:CCGGTACAAGTCGAGAAGTACTAATCTCGAGATTAGTACTTCTCGACTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098729.1-414s21c1
Sequence:CCGGCCAAGATTTAAAGCCTAATAGCTCGAGCTATTAGGCTTTAAATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098729
VALIDATED
GTF2H2B MISSION shRNA shRNA Plasmid DNA
general transcription factor IIH, polypeptide 2B (pseudogene)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000255677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098729.1-723s21c1
Sequence:CCGGTTGCGATCCATCTAATATTTACTCGAGTAAATATTAGATGGATCGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098729.1-1447s21c1
Sequence:CCGGTCTTTAGAAGAAGCTTCATTTCTCGAGAAATGAAGCTTCTTCTAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098729.1-681s21c1
Sequence:CCGGTACAAGTCGAGAAGTACTAATCTCGAGATTAGTACTTCTCGACTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098729.1-414s21c1
Sequence:CCGGCCAAGATTTAAAGCCTAATAGCTCGAGCTATTAGGCTTTAAATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098729
VALIDATED
GTF2H2B MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIH, polypeptide 2B (pseudogene)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000255677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098729.1-723s21c1
Sequence:CCGGTTGCGATCCATCTAATATTTACTCGAGTAAATATTAGATGGATCGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098729.1-1447s21c1
Sequence:CCGGTCTTTAGAAGAAGCTTCATTTCTCGAGAAATGAAGCTTCTTCTAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098729.1-681s21c1
Sequence:CCGGTACAAGTCGAGAAGTACTAATCTCGAGATTAGTACTTCTCGACTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001098729.1-414s21c1
Sequence:CCGGCCAAGATTTAAAGCCTAATAGCTCGAGCTATTAGGCTTTAAATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)