EMAIL THIS PAGE TO A FRIEND

GTF2H2C

general transcription factor IIH, polypeptide 2C

23 Gene Product Result for
Species: Human GTF2H2C(728340)
UniProtKB ID: Q6P1K8, A6NED9, A8K8J6, B2RCU4, B7ZW39
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098728 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098728 Rosetta Predictions human pricing
XM_001713843 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319769 predicted 443
2 SASI_Hs02_00319770 predicted 1017
3 SASI_Hs02_00319771 predicted 517
4 SASI_Hs02_00319772 predicted 1087
5 SASI_Hs02_00319773 predicted 1081
6 SASI_Hs02_00319774 predicted 1019
7 SASI_Hs02_00319775 predicted 426
8 SASI_Hs02_00319776 predicted 1062
9 SASI_Hs02_00319777 predicted 435
10 SASI_Hs02_00319778 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00393296 predicted 43
2 SASI_Hs02_00393297 predicted 229
3 SASI_Hs02_00393298 predicted 161
4 SASI_Hs02_00393299 predicted 72
5 SASI_Hs02_00393300 predicted 304
6 SASI_Hs02_00393301 predicted 254
7 SASI_Hs02_00393302 predicted 81
8 SASI_Hs02_00393303 predicted 156
9 SASI_Hs02_00393304 predicted 218
10 SASI_Hs02_00393305 predicted 90
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098728
GTF2H2C MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIH, polypeptide 2C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098728.1-295s21c1
Sequence:CCGGGGATCACTTAAAGCTACAATACTCGAGTATTGTAGCTTTAAGTGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098728.1-379s21c1
Sequence:CCGGGGAATGATGCGCCACCTTTATCTCGAGATAAAGGTGGCGCATCATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098728.1-430s21c1
Sequence:CCGGGACCAAGATTTAAAGCCTAATCTCGAGATTAGGCTTTAAATCTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098728.1-1564s21c1
Sequence:CCGGTGTCACAGAAATACCTGAAATCTCGAGATTTCAGGTATTTCTGTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098728.1-763s21c1
Sequence:CCGGGATCTAATCAAGACCCTAAAGCTCGAGCTTTAGGGTCTTGATTAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098728
GTF2H2C MISSION shRNA shRNA Plasmid DNA
general transcription factor IIH, polypeptide 2C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098728.1-295s21c1
Sequence:CCGGGGATCACTTAAAGCTACAATACTCGAGTATTGTAGCTTTAAGTGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098728.1-379s21c1
Sequence:CCGGGGAATGATGCGCCACCTTTATCTCGAGATAAAGGTGGCGCATCATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098728.1-430s21c1
Sequence:CCGGGACCAAGATTTAAAGCCTAATCTCGAGATTAGGCTTTAAATCTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098728.1-1564s21c1
Sequence:CCGGTGTCACAGAAATACCTGAAATCTCGAGATTTCAGGTATTTCTGTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098728.1-763s21c1
Sequence:CCGGGATCTAATCAAGACCCTAAAGCTCGAGCTTTAGGGTCTTGATTAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098728
GTF2H2C MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIH, polypeptide 2C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098728.1-295s21c1
Sequence:CCGGGGATCACTTAAAGCTACAATACTCGAGTATTGTAGCTTTAAGTGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098728.1-379s21c1
Sequence:CCGGGGAATGATGCGCCACCTTTATCTCGAGATAAAGGTGGCGCATCATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098728.1-430s21c1
Sequence:CCGGGACCAAGATTTAAAGCCTAATCTCGAGATTAGGCTTTAAATCTTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263118    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098728.1-1564s21c1
Sequence:CCGGTGTCACAGAAATACCTGAAATCTCGAGATTTCAGGTATTTCTGTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098728.1-763s21c1
Sequence:CCGGGATCTAATCAAGACCCTAAAGCTCGAGCTTTAGGGTCTTGATTAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)