EMAIL THIS PAGE TO A FRIEND

GTF2H2D

general transcription factor IIH, polypeptide 2D

16 Gene Product Result for
Species: Human GTF2H2D(730394)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042490 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042490 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310118 predicted 516
2 SASI_Hs02_00310119 predicted 1089
3 SASI_Hs02_00310120 predicted 592
4 SASI_Hs02_00310121 predicted 1153
5 SASI_Hs02_00310122 predicted 1163
6 SASI_Hs02_00310123 predicted 1088
7 SASI_Hs02_00310124 predicted 502
8 SASI_Hs02_00310125 predicted 1128
9 SASI_Hs02_00310126 predicted 511
10 SASI_Hs02_00310127 predicted 1148
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042490
GTF2H2D MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIH, polypeptide 2D
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042490.3-1137s21c1
Sequence:CCGGGCTTACATTAGGAGGCTATTTCTCGAGAAATAGCCTCCTAATGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042490.3-1482s21c1
Sequence:CCGGGCATGTAGTATACATTGTATGCTCGAGCATACAATGTATACTACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042490.3-912s21c1
Sequence:CCGGCACTGTACTTGCTCGTGAAACCTCGAGGTTTCACGAGCAAGTACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042490.3-814s21c1
Sequence:CCGGACTTGCGATCCATCTAATATTCTCGAGAATATTAGATGGATCGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042490.3-1242s21c1
Sequence:CCGGGGCACGGTCTTACCATCATTTCTCGAGAAATGATGGTAAGACCGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042490
GTF2H2D MISSION shRNA shRNA Plasmid DNA
general transcription factor IIH, polypeptide 2D
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042490.3-1137s21c1
Sequence:CCGGGCTTACATTAGGAGGCTATTTCTCGAGAAATAGCCTCCTAATGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042490.3-1482s21c1
Sequence:CCGGGCATGTAGTATACATTGTATGCTCGAGCATACAATGTATACTACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042490.3-912s21c1
Sequence:CCGGCACTGTACTTGCTCGTGAAACCTCGAGGTTTCACGAGCAAGTACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042490.3-814s21c1
Sequence:CCGGACTTGCGATCCATCTAATATTCTCGAGAATATTAGATGGATCGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042490.3-1242s21c1
Sequence:CCGGGGCACGGTCTTACCATCATTTCTCGAGAAATGATGGTAAGACCGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042490
GTF2H2D MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIH, polypeptide 2D
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042490.3-1137s21c1
Sequence:CCGGGCTTACATTAGGAGGCTATTTCTCGAGAAATAGCCTCCTAATGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337299    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001042490.3-1482s21c1
Sequence:CCGGGCATGTAGTATACATTGTATGCTCGAGCATACAATGTATACTACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042490.3-912s21c1
Sequence:CCGGCACTGTACTTGCTCGTGAAACCTCGAGGTTTCACGAGCAAGTACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042490.3-814s21c1
Sequence:CCGGACTTGCGATCCATCTAATATTCTCGAGAATATTAGATGGATCGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042490.3-1242s21c1
Sequence:CCGGGGCACGGTCTTACCATCATTTCTCGAGAAATGATGGTAAGACCGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)