EMAIL THIS PAGE TO A FRIEND

GTF2H3

general transcription factor IIH, polypeptide 3, 34kDa

52 Gene Product Result for
Synonyms: BTF2 P34 TFB4 TFIIH
UniProtKB ID: Q13889, B2R819, Q7L0G0, Q96AT7
Gene ID:
Human(2967) Summary: This gene encodes a member of the TFB4 family. The encoded protein is a subunit of the core-TFIIH basal transcription factor and localizes to the nucleus. The encoded protein is involved in RNA transcription by RNA polymerase II and nucleotide excision repair and associates with the Cdk-activating kinase complex. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 14. [provided by RefSeq, Dec 2012]
Mouse(209357) general transcription factor IIH, polypeptide 3
Rat(288651) general transcription factor IIH, polypeptide 3
Zebrafish(436837) general transcription factor IIH, polypeptide 3
domestic cat(101085499) general transcription factor IIH, polypeptide 3, 34kDa
cow(511896) general transcription factor IIH, polypeptide 3, 34kDa
dog(477446) general transcription factor IIH, polypeptide 3, 34kDa
chicken(771837) general transcription factor IIH, polypeptide 3, 34kDa
domestic guinea pig(100720023) general transcription factor IIH, polypeptide 3, 34kDa
naked mole-rat(101699661) general transcription factor IIH, polypeptide 3, 34kDa
sheep(101116678) general transcription factor IIH, polypeptide 3, 34kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001516 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001516 Rosetta Predictions human pricing
NM_001024236 Rosetta Predictions rat pricing
NM_181410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169063 predicted 292
2 SASI_Hs01_00169065 predicted 527
3 SASI_Hs01_00169066 predicted 346
4 SASI_Hs01_00169067 predicted 796
5 SASI_Hs01_00169068 predicted 641
6 SASI_Hs01_00169069 predicted 718
7 SASI_Hs02_00332033 predicted 218
8 SASI_Hs01_00169070 predicted 193
9 SASI_Hs01_00169072 predicted 387
10 SASI_Hs02_00332034 predicted 730
11 SASI_Hs01_00169064 predicted 456
12 SASI_Hs01_00169071 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063185 predicted 754
2 SASI_Rn02_00202376 predicted 305
3 SASI_Rn01_00063186 predicted 208
4 SASI_Rn01_00063188 predicted 1197
5 SASI_Rn01_00063190 predicted 792
6 SASI_Rn01_00063191 predicted 613
7 SASI_Rn01_00063192 predicted 695
8 SASI_Rn01_00063193 predicted 808
9 SASI_Rn01_00063194 predicted 316
10 SASI_Rn02_00202377 predicted 1263
11 SASI_Rn01_00063187 predicted 827
12 SASI_Rn01_00063189 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349758 predicted 1083
2 SASI_Mm01_00171172 predicted 381
3 SASI_Mm01_00171173 predicted 454
4 SASI_Mm01_00171175 predicted 1125
5 SASI_Mm01_00171176 predicted 611
6 SASI_Mm01_00171177 predicted 465
7 SASI_Mm01_00171178 predicted 1260
8 SASI_Mm01_00171179 predicted 355
9 SASI_Mm01_00171180 predicted 683
10 SASI_Mm01_00171181 predicted 419
11 SASI_Mm01_00171174 predicted 818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001516
VALIDATED
GTF2H3 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIH, polypeptide 3, 34kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001516.3-1298s21c1
Sequence:CCGGATGCATGCCATACGAAATTTGCTCGAGCAAATTTCGTATGGCATGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001516.3-155s21c1
Sequence:CCGGGCTGGGAAATTCGCATTTATTCTCGAGAATAAATGCGAATTTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001516.3-227s21c1
Sequence:CCGGCCGATTCTTATATCCTGGAAACTCGAGTTTCCAGGATATAAGAATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001516.3-786s21c1
Sequence:CCGGGCTTGCTTCTGTCATCGAAATCTCGAGATTTCGATGACAGAAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001516.3-1245s1c1
Sequence:CCGGGACTCATCATAGGCTTTCTAACTCGAGTTAGAAAGCCTATGATGAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001516.3-155s1c1
Sequence:CCGGGCTGGGAAATTCGCATTTATTCTCGAGAATAAATGCGAATTTCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001516.3-686s1c1
Sequence:CCGGGCCTTCTCTTCTGCAGTATTTCTCGAGAAATACTGCAGAAGAGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001516.3-786s1c1
Sequence:CCGGGCTTGCTTCTGTCATCGAAATCTCGAGATTTCGATGACAGAAGCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001516.3-227s1c1
Sequence:CCGGCCGATTCTTATATCCTGGAAACTCGAGTTTCCAGGATATAAGAATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001516
VALIDATED
GTF2H3 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIH, polypeptide 3, 34kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001516.3-1298s21c1
Sequence:CCGGATGCATGCCATACGAAATTTGCTCGAGCAAATTTCGTATGGCATGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001516.3-155s21c1
Sequence:CCGGGCTGGGAAATTCGCATTTATTCTCGAGAATAAATGCGAATTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001516.3-227s21c1
Sequence:CCGGCCGATTCTTATATCCTGGAAACTCGAGTTTCCAGGATATAAGAATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001516.3-786s21c1
Sequence:CCGGGCTTGCTTCTGTCATCGAAATCTCGAGATTTCGATGACAGAAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001516.3-1245s1c1
Sequence:CCGGGACTCATCATAGGCTTTCTAACTCGAGTTAGAAAGCCTATGATGAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001516.3-155s1c1
Sequence:CCGGGCTGGGAAATTCGCATTTATTCTCGAGAATAAATGCGAATTTCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001516.3-686s1c1
Sequence:CCGGGCCTTCTCTTCTGCAGTATTTCTCGAGAAATACTGCAGAAGAGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001516.3-786s1c1
Sequence:CCGGGCTTGCTTCTGTCATCGAAATCTCGAGATTTCGATGACAGAAGCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001516.3-227s1c1
Sequence:CCGGCCGATTCTTATATCCTGGAAACTCGAGTTTCCAGGATATAAGAATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001516
VALIDATED
GTF2H3 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIH, polypeptide 3, 34kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001516.3-1298s21c1
Sequence:CCGGATGCATGCCATACGAAATTTGCTCGAGCAAATTTCGTATGGCATGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001516.3-155s21c1
Sequence:CCGGGCTGGGAAATTCGCATTTATTCTCGAGAATAAATGCGAATTTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001516.3-227s21c1
Sequence:CCGGCCGATTCTTATATCCTGGAAACTCGAGTTTCCAGGATATAAGAATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001516.3-786s21c1
Sequence:CCGGGCTTGCTTCTGTCATCGAAATCTCGAGATTTCGATGACAGAAGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021019    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001516.3-1245s1c1
Sequence:CCGGGACTCATCATAGGCTTTCTAACTCGAGTTAGAAAGCCTATGATGAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001516.3-155s1c1
Sequence:CCGGGCTGGGAAATTCGCATTTATTCTCGAGAATAAATGCGAATTTCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_001516.3-686s1c1
Sequence:CCGGGCCTTCTCTTCTGCAGTATTTCTCGAGAAATACTGCAGAAGAGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001516.3-786s1c1
Sequence:CCGGGCTTGCTTCTGTCATCGAAATCTCGAGATTTCGATGACAGAAGCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001516.3-227s1c1
Sequence:CCGGCCGATTCTTATATCCTGGAAACTCGAGTTTCCAGGATATAAGAATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181410
VALIDATED
GTF2H3 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIH, polypeptide 3, 34kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181410.2-1261s21c1
Sequence:CCGGTGATCCTCTGTCAGCGCTTATCTCGAGATAAGCGCTGACAGAGGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181410.2-94s21c1
Sequence:CCGGGCATTAAAGGAATCTCAGTTTCTCGAGAAACTGAGATTCCTTTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181410.2-447s21c1
Sequence:CCGGCTACATTCACAGAGTGAACAACTCGAGTTGTTCACTCTGTGAATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181410.2-324s21c1
Sequence:CCGGCGAGCTGTTGACAGTTGCAAACTCGAGTTTGCAACTGTCAACAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181410.2-59s21c1
Sequence:CCGGTAGTTGACACCAACCCGATTTCTCGAGAAATCGGGTTGGTGTCAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181410.2-1370s1c1
Sequence:CCGGGCAGTCATAACAGAGCATCTTCTCGAGAAGATGCTCTGTTATGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181410.2-456s1c1
Sequence:CCGGCAGAGTGAACAAGGCAGTTAACTCGAGTTAACTGCCTTGTTCACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181410.2-94s1c1
Sequence:CCGGGCATTAAAGGAATCTCAGTTTCTCGAGAAACTGAGATTCCTTTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181410.2-447s1c1
Sequence:CCGGCTACATTCACAGAGTGAACAACTCGAGTTGTTCACTCTGTGAATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181410.2-324s1c1
Sequence:CCGGCGAGCTGTTGACAGTTGCAAACTCGAGTTTGCAACTGTCAACAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181410
VALIDATED
GTF2H3 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIH, polypeptide 3, 34kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181410.2-1261s21c1
Sequence:CCGGTGATCCTCTGTCAGCGCTTATCTCGAGATAAGCGCTGACAGAGGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181410.2-94s21c1
Sequence:CCGGGCATTAAAGGAATCTCAGTTTCTCGAGAAACTGAGATTCCTTTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181410.2-447s21c1
Sequence:CCGGCTACATTCACAGAGTGAACAACTCGAGTTGTTCACTCTGTGAATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181410.2-324s21c1
Sequence:CCGGCGAGCTGTTGACAGTTGCAAACTCGAGTTTGCAACTGTCAACAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181410.2-59s21c1
Sequence:CCGGTAGTTGACACCAACCCGATTTCTCGAGAAATCGGGTTGGTGTCAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181410.2-1370s1c1
Sequence:CCGGGCAGTCATAACAGAGCATCTTCTCGAGAAGATGCTCTGTTATGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181410.2-456s1c1
Sequence:CCGGCAGAGTGAACAAGGCAGTTAACTCGAGTTAACTGCCTTGTTCACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181410.2-94s1c1
Sequence:CCGGGCATTAAAGGAATCTCAGTTTCTCGAGAAACTGAGATTCCTTTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181410.2-447s1c1
Sequence:CCGGCTACATTCACAGAGTGAACAACTCGAGTTGTTCACTCTGTGAATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181410.2-324s1c1
Sequence:CCGGCGAGCTGTTGACAGTTGCAAACTCGAGTTTGCAACTGTCAACAGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181410
VALIDATED
GTF2H3 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIH, polypeptide 3, 34kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181410.2-1261s21c1
Sequence:CCGGTGATCCTCTGTCAGCGCTTATCTCGAGATAAGCGCTGACAGAGGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181410.2-94s21c1
Sequence:CCGGGCATTAAAGGAATCTCAGTTTCTCGAGAAACTGAGATTCCTTTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181410.2-447s21c1
Sequence:CCGGCTACATTCACAGAGTGAACAACTCGAGTTGTTCACTCTGTGAATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181410.2-324s21c1
Sequence:CCGGCGAGCTGTTGACAGTTGCAAACTCGAGTTTGCAACTGTCAACAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181410.2-59s21c1
Sequence:CCGGTAGTTGACACCAACCCGATTTCTCGAGAAATCGGGTTGGTGTCAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084603    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181410.2-1370s1c1
Sequence:CCGGGCAGTCATAACAGAGCATCTTCTCGAGAAGATGCTCTGTTATGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181410.2-456s1c1
Sequence:CCGGCAGAGTGAACAAGGCAGTTAACTCGAGTTAACTGCCTTGTTCACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181410.2-94s1c1
Sequence:CCGGGCATTAAAGGAATCTCAGTTTCTCGAGAAACTGAGATTCCTTTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181410.2-447s1c1
Sequence:CCGGCTACATTCACAGAGTGAACAACTCGAGTTGTTCACTCTGTGAATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181410.2-324s1c1
Sequence:CCGGCGAGCTGTTGACAGTTGCAAACTCGAGTTTGCAACTGTCAACAGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)