EMAIL THIS PAGE TO A FRIEND

GTF2H4

general transcription factor IIH, polypeptide 4, 52kDa

61 Gene Product Result for
Synonyms: P52 TFB2 TFIIH
UniProtKB ID: Q92759, Q76KU4
Gene ID:
Mouse(14885) general transcription factor II H, polypeptide 4
Rat(294236) general transcription factor II H, polypeptide 4
Zebrafish(334839) general transcription factor IIH, polypeptide 4
chicken(417256) general transcription factor IIH, polypeptide 4, 52kDa
domestic cat(101097482) general transcription factor IIH, polypeptide 4, 52kDa
Horse(100630479) general transcription factor IIH, polypeptide 4, 52kDa
dog(606988) general transcription factor IIH, polypeptide 4, 52kDa
cow(100137723) general transcription factor IIH, polypeptide 4, 52kDa
Goat(100861324) general transcription factor IIH, polypeptide 4, 52kDa
sheep(101102343) general transcription factor IIH, polypeptide 4, 52kDa
domestic guinea pig(101787652) general transcription factor IIH, polypeptide 4, 52kDa
naked mole-rat(101698842) general transcription factor IIH, polypeptide 4, 52kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010364 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010364 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010364 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001517 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001517 Rosetta Predictions human pricing
NM_212501 Rosetta Predictions rat pricing
NM_010364 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025797 predicted 945
2 SASI_Hs01_00025798 predicted 1138
3 SASI_Hs01_00025799 predicted 1111
4 SASI_Hs01_00025801 predicted 253
5 SASI_Hs02_00332035 predicted 939
6 SASI_Hs01_00025802 predicted 1289
7 SASI_Hs01_00025803 predicted 990
8 SASI_Hs01_00025804 predicted 1032
9 SASI_Hs02_00332036 predicted 1121
10 SASI_Hs01_00025805 predicted 1199
11 SASI_Hs01_00025800 predicted 1278
12 SASI_Hs01_00025806 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212501 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095007 predicted 1208
2 SASI_Rn01_00095008 predicted 1243
3 SASI_Rn01_00095009 predicted 389
4 SASI_Rn01_00095010 predicted 525
5 SASI_Rn01_00095011 predicted 920
6 SASI_Rn01_00095012 predicted 1041
7 SASI_Rn01_00095013 predicted 1048
8 SASI_Rn01_00095014 predicted 378
9 SASI_Rn01_00095016 predicted 1124
10 SASI_Rn02_00270484 predicted 264
11 SASI_Rn01_00095015 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010364 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194420 predicted 1072
2 SASI_Mm01_00194421 predicted 524
3 SASI_Mm01_00194422 predicted 1074
4 SASI_Mm01_00194423 predicted 1048
5 SASI_Mm01_00194424 predicted 443
6 SASI_Mm01_00194425 predicted 1037
7 SASI_Mm01_00194426 predicted 851
8 SASI_Mm01_00194427 predicted 1367
9 SASI_Mm02_00318411 predicted 761
10 SASI_Mm01_00194428 predicted 955
11 SASI_Mm01_00194419 predicted 1252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010364
VALIDATED
GTF2H4 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIH, polypeptide 4, 52kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010364.1-170s1c1
Sequence:CCGGGCACACCTACAATGCAGGAATCTCGAGATTCCTGCATTGTAGGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010364.1-1256s1c1
Sequence:CCGGCCAGTGATGCTCAAACAGAATCTCGAGATTCTGTTTGAGCATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010364.1-1289s1c1
Sequence:CCGGCCCACCATAACAGACCAGATTCTCGAGAATCTGGTCTGTTATGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010364.1-898s1c1
Sequence:CCGGGAGTGACTCTTTGTTGAACTTCTCGAGAAGTTCAACAAAGAGTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010364.1-1354s1c1
Sequence:CCGGCGTCCTGTATAACCAGTTCCTCTCGAGAGGAACTGGTTATACAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010364.3-1351s21c1
Sequence:CCGGCGTCCTGTATAACCAGTTCCTCTCGAGAGGAACTGGTTATACAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010364.3-1253s21c1
Sequence:CCGGCCAGTGATGCTCAAACAGAATCTCGAGATTCTGTTTGAGCATCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010364.3-167s21c1
Sequence:CCGGGCACACCTACAATGCAGGAATCTCGAGATTCCTGCATTGTAGGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010364.3-895s21c1
Sequence:CCGGGAGTGACTCTTTGTTGAACTTCTCGAGAAGTTCAACAAAGAGTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010364
VALIDATED
GTF2H4 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIH, polypeptide 4, 52kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010364.1-170s1c1
Sequence:CCGGGCACACCTACAATGCAGGAATCTCGAGATTCCTGCATTGTAGGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010364.1-1256s1c1
Sequence:CCGGCCAGTGATGCTCAAACAGAATCTCGAGATTCTGTTTGAGCATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010364.1-1289s1c1
Sequence:CCGGCCCACCATAACAGACCAGATTCTCGAGAATCTGGTCTGTTATGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010364.1-898s1c1
Sequence:CCGGGAGTGACTCTTTGTTGAACTTCTCGAGAAGTTCAACAAAGAGTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010364.1-1354s1c1
Sequence:CCGGCGTCCTGTATAACCAGTTCCTCTCGAGAGGAACTGGTTATACAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010364.3-1351s21c1
Sequence:CCGGCGTCCTGTATAACCAGTTCCTCTCGAGAGGAACTGGTTATACAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010364.3-1253s21c1
Sequence:CCGGCCAGTGATGCTCAAACAGAATCTCGAGATTCTGTTTGAGCATCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010364.3-167s21c1
Sequence:CCGGGCACACCTACAATGCAGGAATCTCGAGATTCCTGCATTGTAGGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010364.3-895s21c1
Sequence:CCGGGAGTGACTCTTTGTTGAACTTCTCGAGAAGTTCAACAAAGAGTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010364
VALIDATED
GTF2H4 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIH, polypeptide 4, 52kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010364.1-170s1c1
Sequence:CCGGGCACACCTACAATGCAGGAATCTCGAGATTCCTGCATTGTAGGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010364.1-1256s1c1
Sequence:CCGGCCAGTGATGCTCAAACAGAATCTCGAGATTCTGTTTGAGCATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010364.1-1289s1c1
Sequence:CCGGCCCACCATAACAGACCAGATTCTCGAGAATCTGGTCTGTTATGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010364.1-898s1c1
Sequence:CCGGGAGTGACTCTTTGTTGAACTTCTCGAGAAGTTCAACAAAGAGTCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010364.1-1354s1c1
Sequence:CCGGCGTCCTGTATAACCAGTTCCTCTCGAGAGGAACTGGTTATACAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010364.3-1351s21c1
Sequence:CCGGCGTCCTGTATAACCAGTTCCTCTCGAGAGGAACTGGTTATACAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010364.3-1253s21c1
Sequence:CCGGCCAGTGATGCTCAAACAGAATCTCGAGATTCTGTTTGAGCATCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010364.3-167s21c1
Sequence:CCGGGCACACCTACAATGCAGGAATCTCGAGATTCCTGCATTGTAGGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010364.3-895s21c1
Sequence:CCGGGAGTGACTCTTTGTTGAACTTCTCGAGAAGTTCAACAAAGAGTCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001517
GTF2H4 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIH, polypeptide 4, 52kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-1200s1c1
Sequence:CCGGCTCTGAGATGCTCTATCGGTTCTCGAGAACCGATAGAGCATCTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-969s1c1
Sequence:CCGGGAGTGATTCTCTGTTGAACTTCTCGAGAAGTTCAACAGAGAATCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-1291s1c1
Sequence:CCGGCAGCAGATAATCCATTTCCTACTCGAGTAGGAAATGGATTATCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-234s1c1
Sequence:CCGGGAACCGAGTACACCTACAATGCTCGAGCATTGTAGGTGTACTCGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-833s1c1
Sequence:CCGGCGGCTCAGCTCTGGTACTTTACTCGAGTAAAGTACCAGAGCTGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001517
GTF2H4 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIH, polypeptide 4, 52kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-1200s1c1
Sequence:CCGGCTCTGAGATGCTCTATCGGTTCTCGAGAACCGATAGAGCATCTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-969s1c1
Sequence:CCGGGAGTGATTCTCTGTTGAACTTCTCGAGAAGTTCAACAGAGAATCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-1291s1c1
Sequence:CCGGCAGCAGATAATCCATTTCCTACTCGAGTAGGAAATGGATTATCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-234s1c1
Sequence:CCGGGAACCGAGTACACCTACAATGCTCGAGCATTGTAGGTGTACTCGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000220070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-833s1c1
Sequence:CCGGCGGCTCAGCTCTGGTACTTTACTCGAGTAAAGTACCAGAGCTGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001517
GTF2H4 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIH, polypeptide 4, 52kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-1200s1c1
Sequence:CCGGCTCTGAGATGCTCTATCGGTTCTCGAGAACCGATAGAGCATCTCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-969s1c1
Sequence:CCGGGAGTGATTCTCTGTTGAACTTCTCGAGAAGTTCAACAGAGAATCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-1291s1c1
Sequence:CCGGCAGCAGATAATCCATTTCCTACTCGAGTAGGAAATGGATTATCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-234s1c1
Sequence:CCGGGAACCGAGTACACCTACAATGCTCGAGCATTGTAGGTGTACTCGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000220070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001517.4-833s1c1
Sequence:CCGGCGGCTCAGCTCTGGTACTTTACTCGAGTAAAGTACCAGAGCTGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)