EMAIL THIS PAGE TO A FRIEND

GTF2H5

general transcription factor IIH, polypeptide 5

51 Gene Product Result for
Synonyms: C6orf175 TFB5 TFIIH TGF2H5 TTD TTD-A TTDA bA120J8.2
UniProtKB ID: Q6ZYL4, Q0P5V8
Gene ID:
Human(404672) Summary: This gene encodes a subunit of transcription/repair factor TFIIH, which functions in gene transcription and DNA repair. This protein stimulates ERCC3/XPB ATPase activity to trigger DNA opening during DNA repair, and is implicated in regulating cellular levels of TFIIH. Mutations in this gene result in trichothiodystrophy, complementation group A. [provided by RefSeq, Mar 2009]
Mouse(66467) general transcription factor IIH, polypeptide 5
Rat(502227) general transcription factor IIH, polypeptide 5
domestic guinea pig(100717456) general transcription factor IIH, polypeptide 5
sheep(101108496) general transcription factor IIH, polypeptide 5
Zebrafish(751713) general transcription factor IIH, polypeptide 5
chicken(769754) general transcription factor IIH, polypeptide 5
domestic cat(101087996) general transcription factor IIH, polypeptide 5
cow(518046) general transcription factor IIH, polypeptide 5
dog(612182) general transcription factor IIH, polypeptide 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107159 Anti-GTF2H5 antibody produced in rabbit affinity isolated antibody human, rabbit, guinea pig, mouse
ELISA, western blot pricing
T9702 Anti-p8/TTD-A (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunofluorescence, western blot pricing
T9577 Anti-p8/TTD-A (N-terminal) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human, rat
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207118 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207118 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207118 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207118 Rosetta Predictions human pricing
NM_001126088 Rosetta Predictions rat pricing
NM_181392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133930 predicted 201
2 SASI_Hs01_00133931 predicted 194
3 SASI_Hs01_00133932 predicted 199
4 SASI_Hs01_00133933 predicted 196
5 SASI_Hs01_00133934 predicted 369
6 SASI_Hs01_00133935 predicted 40
7 SASI_Hs01_00133936 predicted 62
8 SASI_Hs01_00133938 predicted 39
9 SASI_Hs02_00373767 predicted 127
10 SASI_Hs02_00373768 predicted 376
11 SASI_Hs01_00133937 predicted 260
12 SASI_Hs01_00133939 predicted 156
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252893 predicted 523
2 SASI_Rn02_00252894 predicted 727
3 SASI_Rn02_00252895 predicted 455
4 SASI_Rn02_00252896 predicted 317
5 SASI_Rn02_00252897 predicted 745
6 SASI_Rn02_00252898 predicted 394
7 SASI_Rn02_00252899 predicted 683
8 SASI_Rn02_00252900 predicted 196
9 SASI_Rn02_00252901 predicted 458
10 SASI_Rn02_00252902 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150514 predicted 230
2 SASI_Mm01_00150515 predicted 244
3 SASI_Mm02_00349734 predicted 214
4 SASI_Mm01_00150516 predicted 718
5 SASI_Mm01_00150517 predicted 802
6 SASI_Mm01_00150518 predicted 771
7 SASI_Mm01_00150519 predicted 449
8 SASI_Mm01_00150520 predicted 753
9 SASI_Mm01_00150521 predicted 428
10 SASI_Mm01_00150522 predicted 762
11 SASI_Mm01_00150523 predicted 585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181392
VALIDATED
GTF2H5 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIH, polypeptide 5
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181392.3-152s21c1
Sequence:CCGGAGAATGTGACCCTGCCATGAACTCGAGTTCATGGCAGGGTCACATTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181392.1-681s1c1
Sequence:CCGGCCACACAAATACGGAAATATACTCGAGTATATTTCCGTATTTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181392.1-182s1c1
Sequence:CCGGGTTCATCATTCAGGACATTGACTCGAGTCAATGTCCTGAATGATGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181392.1-264s1c1
Sequence:CCGGCTGATGGACCAGAATGCCTTTCTCGAGAAAGGCATTCTGGTCCATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181392.1-146s1c1
Sequence:CCGGGCTGTACTTGGATGAGGCCAACTCGAGTTGGCCTCATCCAAGTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181392.1-204s1c1
Sequence:CCGGGACACGCACGTCTTCGTCATTCTCGAGAATGACGAAGACGTGCGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181392
VALIDATED
GTF2H5 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIH, polypeptide 5
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181392.3-152s21c1
Sequence:CCGGAGAATGTGACCCTGCCATGAACTCGAGTTCATGGCAGGGTCACATTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181392.1-681s1c1
Sequence:CCGGCCACACAAATACGGAAATATACTCGAGTATATTTCCGTATTTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181392.1-182s1c1
Sequence:CCGGGTTCATCATTCAGGACATTGACTCGAGTCAATGTCCTGAATGATGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181392.1-264s1c1
Sequence:CCGGCTGATGGACCAGAATGCCTTTCTCGAGAAAGGCATTCTGGTCCATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181392.1-146s1c1
Sequence:CCGGGCTGTACTTGGATGAGGCCAACTCGAGTTGGCCTCATCCAAGTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181392.1-204s1c1
Sequence:CCGGGACACGCACGTCTTCGTCATTCTCGAGAATGACGAAGACGTGCGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181392
VALIDATED
GTF2H5 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIH, polypeptide 5
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181392.3-152s21c1
Sequence:CCGGAGAATGTGACCCTGCCATGAACTCGAGTTCATGGCAGGGTCACATTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181392.1-681s1c1
Sequence:CCGGCCACACAAATACGGAAATATACTCGAGTATATTTCCGTATTTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181392.1-182s1c1
Sequence:CCGGGTTCATCATTCAGGACATTGACTCGAGTCAATGTCCTGAATGATGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181392.1-264s1c1
Sequence:CCGGCTGATGGACCAGAATGCCTTTCTCGAGAAAGGCATTCTGGTCCATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181392.1-146s1c1
Sequence:CCGGGCTGTACTTGGATGAGGCCAACTCGAGTTGGCCTCATCCAAGTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_181392.1-204s1c1
Sequence:CCGGGACACGCACGTCTTCGTCATTCTCGAGAATGACGAAGACGTGCGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207118
GTF2H5 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIH, polypeptide 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-161s1c1
Sequence:CCGGCGTCTTTGTAATAGCAGAATTCTCGAGAATTCTGCTATTACAAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-205s1c1
Sequence:CCGGTGGGTGAATTAATGGACCAAACTCGAGTTTGGTCCATTAATTCACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-150s1c1
Sequence:CCGGGATGACACTCACGTCTTTGTACTCGAGTACAAAGACGTGAGTGTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-72s1c1
Sequence:CCGGGATCCTGCCATGAAGCAGTTTCTCGAGAAACTGCTTCATGGCAGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-96s1c1
Sequence:CCGGCTGTACTTGGATGAGTCCAATCTCGAGATTGGACTCATCCAAGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207118
GTF2H5 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIH, polypeptide 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-161s1c1
Sequence:CCGGCGTCTTTGTAATAGCAGAATTCTCGAGAATTCTGCTATTACAAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-205s1c1
Sequence:CCGGTGGGTGAATTAATGGACCAAACTCGAGTTTGGTCCATTAATTCACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-150s1c1
Sequence:CCGGGATGACACTCACGTCTTTGTACTCGAGTACAAAGACGTGAGTGTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-72s1c1
Sequence:CCGGGATCCTGCCATGAAGCAGTTTCTCGAGAAACTGCTTCATGGCAGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-96s1c1
Sequence:CCGGCTGTACTTGGATGAGTCCAATCTCGAGATTGGACTCATCCAAGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207118
GTF2H5 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIH, polypeptide 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-161s1c1
Sequence:CCGGCGTCTTTGTAATAGCAGAATTCTCGAGAATTCTGCTATTACAAAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-205s1c1
Sequence:CCGGTGGGTGAATTAATGGACCAAACTCGAGTTTGGTCCATTAATTCACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-150s1c1
Sequence:CCGGGATGACACTCACGTCTTTGTACTCGAGTACAAAGACGTGAGTGTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-72s1c1
Sequence:CCGGGATCCTGCCATGAAGCAGTTTCTCGAGAAACTGCTTCATGGCAGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207118.1-96s1c1
Sequence:CCGGCTGTACTTGGATGAGTCCAATCTCGAGATTGGACTCATCCAAGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)