EMAIL THIS PAGE TO A FRIEND

GTF2I

general transcription factor IIi

235 Gene Product Result for
Synonyms: BAP135 BTKAP1 DIWS GTFII-I IB291 SPIN TFII-I WBS WBSCR6
Gene ID:
Human(2969) Summary: This gene encodes a multifunctional phosphoprotein with roles in transcription and signal transduction. It is deleted in Williams-Beuren syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at chromosome 7q11.23. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 7, 13 and 21. [provided by RefSeq, Jul 2009]
Mouse(14886) general transcription factor II I
Rat(353256) general transcription factor II I
chicken(417486) general transcription factor IIi
cow(534669) general transcription factor IIi
Horse(100060007) general transcription factor IIi
domestic cat(101095393) general transcription factor IIi
dog(479714) general transcription factor IIi
sheep(101113297) general transcription factor IIi
Domestic Rabbit(100339683) general transcription factor IIi
domestic guinea pig(100724513) general transcription factor IIi
naked mole-rat(101722019) general transcription factor IIi
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001518 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001518 Rosetta Predictions human pricing
NM_032999 Rosetta Predictions human pricing
NM_033000 Rosetta Predictions human pricing
NM_033001 Rosetta Predictions human pricing
NM_001001512 Rosetta Predictions rat pricing
XM_579056 Rosetta Predictions rat pricing
NM_001080746 Rosetta Predictions mouse pricing
NM_001080747 Rosetta Predictions mouse pricing
NM_001080748 Rosetta Predictions mouse pricing
NM_001080749 Rosetta Predictions mouse pricing
NM_010365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332037 predicted 2788
2 SASI_Hs02_00332038 predicted 3333
3 SASI_Hs02_00332039 predicted 1500
4 SASI_Hs01_00079907 predicted 2873
5 SASI_Hs02_00332040 predicted 1912
6 SASI_Hs01_00079909 predicted 656
7 SASI_Hs01_00079910 predicted 3082
8 SASI_Hs01_00079911 predicted 2882
9 SASI_Hs02_00332041 predicted 1579
10 SASI_Hs02_00332042 predicted 2381
11 SASI_Hs01_00079904 predicted 2854
12 SASI_Hs01_00079905 predicted 2918
13 SASI_Hs01_00079906 predicted 3009
14 SASI_Hs01_00079908 predicted 868
15 SASI_Hs01_00079912 predicted 2278
16 SASI_Hs01_00079913 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360646 predicted 2915
2 SASI_Hs02_00360647 predicted 3459
3 SASI_Hs02_00360648 predicted 1623
4 SASI_Hs01_00153248 predicted 3002
5 SASI_Hs02_00360649 predicted 2027
6 SASI_Hs01_00153250 predicted 663
7 SASI_Hs01_00153251 predicted 3202
8 SASI_Hs01_00153252 predicted 3006
9 SASI_Hs02_00360650 predicted 1702
10 SASI_Hs02_00360651 predicted 2508
11 SASI_Hs01_00153245 predicted 2979
12 SASI_Hs01_00153246 predicted 3036
13 SASI_Hs01_00153247 predicted 3127
14 SASI_Hs01_00153249 predicted 873
15 SASI_Hs01_00153253 predicted 2399
16 SASI_Hs01_00153254 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360652 predicted 2849
2 SASI_Hs02_00360653 predicted 3399
3 SASI_Hs02_00360654 predicted 1565
4 SASI_Hs01_00057600 predicted 2942
5 SASI_Hs02_00360655 predicted 1970
6 SASI_Hs01_00057602 predicted 658
7 SASI_Hs01_00057603 predicted 3144
8 SASI_Hs01_00057604 predicted 2950
9 SASI_Hs02_00360656 predicted 1647
10 SASI_Hs02_00360657 predicted 2444
11 SASI_Hs01_00057597 predicted 2912
12 SASI_Hs01_00057598 predicted 2974
13 SASI_Hs01_00057599 predicted 3073
14 SASI_Hs01_00057601 predicted 867
15 SASI_Hs01_00057605 predicted 2338
16 SASI_Hs01_00057606 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360658 predicted 2849
2 SASI_Hs02_00360659 predicted 3388
3 SASI_Hs02_00360660 predicted 1565
4 SASI_Hs01_00208477 predicted 2938
5 SASI_Hs02_00360661 predicted 1967
6 SASI_Hs01_00208479 predicted 661
7 SASI_Hs01_00208480 predicted 3139
8 SASI_Hs01_00208481 predicted 2946
9 SASI_Hs02_00360662 predicted 1645
10 SASI_Hs02_00360663 predicted 2444
11 SASI_Hs01_00208474 predicted 2910
12 SASI_Hs01_00208475 predicted 2970
13 SASI_Hs01_00208476 predicted 3065
14 SASI_Hs01_00208478 predicted 874
15 SASI_Hs01_00208482 predicted 2332
16 SASI_Hs01_00208483 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051134 predicted 1494
2 SASI_Rn01_00051135 predicted 2153
3 SASI_Rn01_00051136 predicted 2300
4 SASI_Rn01_00051137 predicted 315
5 SASI_Rn01_00051138 predicted 2993
6 SASI_Rn01_00051139 predicted 2470
7 SASI_Rn01_00051140 predicted 481
8 SASI_Rn01_00051141 predicted 2531
9 SASI_Rn01_00051142 predicted 2083
10 SASI_Rn01_00051143 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00167982 predicted 1532
2 SASI_Rn01_00167983 predicted 2193
3 SASI_Rn01_00167984 predicted 2348
4 SASI_Rn01_00167985 predicted 2197
5 SASI_Rn01_00167986 predicted 2507
6 SASI_Rn01_00167987 predicted 326
7 SASI_Rn01_00167988 predicted 2576
8 SASI_Rn01_00167989 predicted 2122
9 SASI_Rn01_00167990 predicted 1201
10 SASI_Rn01_00167991 predicted 1542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293613 predicted 2614
2 SASI_Mm02_00293614 predicted 1961
3 SASI_Mm02_00293615 predicted 850
4 SASI_Mm02_00293616 predicted 2481
5 SASI_Mm02_00293617 predicted 687
6 SASI_Mm02_00293618 predicted 1687
7 SASI_Mm02_00293619 predicted 3201
8 SASI_Mm02_00293620 predicted 2615
9 SASI_Mm02_00293621 predicted 1627
10 SASI_Mm02_00293622 predicted 3437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293623 predicted 2553
2 SASI_Mm02_00293624 predicted 1891
3 SASI_Mm02_00293625 predicted 849
4 SASI_Mm02_00293626 predicted 2414
5 SASI_Mm02_00293627 predicted 690
6 SASI_Mm02_00293628 predicted 1630
7 SASI_Mm02_00293629 predicted 3138
8 SASI_Mm02_00293630 predicted 2553
9 SASI_Mm02_00293631 predicted 1562
10 SASI_Mm02_00293632 predicted 3374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080748 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293633 predicted 2488
2 SASI_Mm02_00293634 predicted 1832
3 SASI_Mm02_00293635 predicted 845
4 SASI_Mm02_00293636 predicted 2358
5 SASI_Mm02_00293637 predicted 687
6 SASI_Mm02_00293638 predicted 1574
7 SASI_Mm02_00293639 predicted 3084
8 SASI_Mm02_00293640 predicted 2498
9 SASI_Mm02_00293641 predicted 1506
10 SASI_Mm02_00293642 predicted 3310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080749 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293643 predicted 2497
2 SASI_Mm02_00293644 predicted 1841
3 SASI_Mm02_00293645 predicted 853
4 SASI_Mm02_00293646 predicted 2357
5 SASI_Mm02_00293647 predicted 689
6 SASI_Mm02_00293648 predicted 1569
7 SASI_Mm02_00293649 predicted 3088
8 SASI_Mm02_00293650 predicted 2497
9 SASI_Mm02_00293651 predicted 1503
10 SASI_Mm02_00293652 predicted 3326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318412 predicted 2558
2 SASI_Mm02_00318413 predicted 1897
3 SASI_Mm01_00154825 predicted 854
4 SASI_Mm02_00318414 predicted 2427
5 SASI_Mm01_00154831 predicted 688
6 SASI_Mm01_00154832 predicted 1636
7 SASI_Mm01_00154833 predicted 3140
8 SASI_Mm02_00318415 predicted 2553
9 SASI_Mm02_00318416 predicted 1572
10 SASI_Mm02_00318417 predicted 3374
11 SASI_Mm01_00154824 predicted 960
12 SASI_Mm01_00154826 predicted 1751
13 SASI_Mm01_00154827 predicted 307
14 SASI_Mm01_00154828 predicted 3100
15 SASI_Mm01_00154829 predicted 2663
16 SASI_Mm01_00154830 predicted 1697
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010365
VALIDATED
GTF2I MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIi
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010365.1-3390s1c1
Sequence:CCGGCCTGTGCTAGTCAGTGCTTTACTCGAGTAAAGCACTGACTAGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010365.1-1522s1c1
Sequence:CCGGCCCAATGATCTCTATGTGGAACTCGAGTTCCACATAGAGATCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010365.1-820s1c1
Sequence:CCGGGACCCTGATTACTATCAGTATCTCGAGATACTGATAGTAATCAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010365.1-2952s1c1
Sequence:CCGGCCCAGTAACAGAAGAAATTAACTCGAGTTAATTTCTTCTGTTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010365.1-898s1c1
Sequence:CCGGCCAGCAGAAGATTCTACTCAACTCGAGTTGAGTAGAATCTTCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010365.3-1102s21c1
Sequence:CCGGGACCCTGATTACTATCAGTATCTCGAGATACTGATAGTAATCAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010365.3-1561s21c1
Sequence:CCGGCCTCGCCTTGAGAGGATATTGCTCGAGCAATATCCTCTCAAGGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010365.3-1896s21c1
Sequence:CCGGCCAAGTGGGCAATCGAATTAACTCGAGTTAATTCGATTGCCCACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010365.3-2798s21c1
Sequence:CCGGACTCATCACCCAACGTTAATACTCGAGTATTAACGTTGGGTGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010365.3-3684s21c1
Sequence:CCGGCCTGTGCTAGTCAGTGCTTTACTCGAGTAAAGCACTGACTAGCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010365
VALIDATED
GTF2I MISSION shRNA shRNA Plasmid DNA
general transcription factor IIi
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010365.1-3390s1c1
Sequence:CCGGCCTGTGCTAGTCAGTGCTTTACTCGAGTAAAGCACTGACTAGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010365.1-1522s1c1
Sequence:CCGGCCCAATGATCTCTATGTGGAACTCGAGTTCCACATAGAGATCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010365.1-820s1c1
Sequence:CCGGGACCCTGATTACTATCAGTATCTCGAGATACTGATAGTAATCAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010365.1-2952s1c1
Sequence:CCGGCCCAGTAACAGAAGAAATTAACTCGAGTTAATTTCTTCTGTTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010365.1-898s1c1
Sequence:CCGGCCAGCAGAAGATTCTACTCAACTCGAGTTGAGTAGAATCTTCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010365.3-1102s21c1
Sequence:CCGGGACCCTGATTACTATCAGTATCTCGAGATACTGATAGTAATCAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010365.3-1561s21c1
Sequence:CCGGCCTCGCCTTGAGAGGATATTGCTCGAGCAATATCCTCTCAAGGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010365.3-1896s21c1
Sequence:CCGGCCAAGTGGGCAATCGAATTAACTCGAGTTAATTCGATTGCCCACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010365.3-2798s21c1
Sequence:CCGGACTCATCACCCAACGTTAATACTCGAGTATTAACGTTGGGTGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010365.3-3684s21c1
Sequence:CCGGCCTGTGCTAGTCAGTGCTTTACTCGAGTAAAGCACTGACTAGCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010365
VALIDATED
GTF2I MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIi
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086098    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010365.1-3390s1c1
Sequence:CCGGCCTGTGCTAGTCAGTGCTTTACTCGAGTAAAGCACTGACTAGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010365.1-1522s1c1
Sequence:CCGGCCCAATGATCTCTATGTGGAACTCGAGTTCCACATAGAGATCATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010365.1-820s1c1
Sequence:CCGGGACCCTGATTACTATCAGTATCTCGAGATACTGATAGTAATCAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010365.1-2952s1c1
Sequence:CCGGCCCAGTAACAGAAGAAATTAACTCGAGTTAATTTCTTCTGTTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010365.1-898s1c1
Sequence:CCGGCCAGCAGAAGATTCTACTCAACTCGAGTTGAGTAGAATCTTCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010365.3-1102s21c1
Sequence:CCGGGACCCTGATTACTATCAGTATCTCGAGATACTGATAGTAATCAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010365.3-1561s21c1
Sequence:CCGGCCTCGCCTTGAGAGGATATTGCTCGAGCAATATCCTCTCAAGGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010365.3-1896s21c1
Sequence:CCGGCCAAGTGGGCAATCGAATTAACTCGAGTTAATTCGATTGCCCACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010365.3-2798s21c1
Sequence:CCGGACTCATCACCCAACGTTAATACTCGAGTATTAACGTTGGGTGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010365.3-3684s21c1
Sequence:CCGGCCTGTGCTAGTCAGTGCTTTACTCGAGTAAAGCACTGACTAGCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001518
VALIDATED
GTF2I MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIi
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001518.2-4070s1c1
Sequence:CCGGCGGCATTATTTCCTAGTTCTTCTCGAGAAGAACTAGGAAATAATGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001518.2-1041s1c1
Sequence:CCGGCCACAGAAGATTCTGGCATTTCTCGAGAAATGCCAGAATCTTCTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001518.2-855s1c1
Sequence:CCGGCCGAGAACTATGATCTTGCAACTCGAGTTGCAAGATCATAGTTCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001518.2-671s1c1
Sequence:CCGGCGGATGAGTGTAGATGCTGTACTCGAGTACAGCATCTACACTCATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001518.2-1181s1c1
Sequence:CCGGCCAGCAGAAGATGATGATTATCTCGAGATAATCATCATCTTCTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-959s21c1
Sequence:CCGGGGTCGTGTGATGGTAACAGATCTCGAGATCTGTTACCATCACACGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-1070s21c1
Sequence:CCGGATGGCAGCTGTGACAGTAAAGCTCGAGCTTTACTGTCACAGCTGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-657s21c1
Sequence:CCGGCAACCCAGGCAAATCGGATGACTCGAGTCATCCGATTTGCCTGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001518.3-1182s21c1
Sequence:CCGGCAGCAGAAGATGATGATTATTCTCGAGAATAATCATCATCTTCTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-979s21c1
Sequence:CCGGTGCTGACAGGTCAATACTATCCTCGAGGATAGTATTGACCTGTCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-741s21c1
Sequence:CCGGATGGGAAAGCTTTAGGCAAATCTCGAGATTTGCCTAAAGCTTTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001518
VALIDATED
GTF2I MISSION shRNA shRNA Plasmid DNA
general transcription factor IIi
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001518.2-4070s1c1
Sequence:CCGGCGGCATTATTTCCTAGTTCTTCTCGAGAAGAACTAGGAAATAATGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001518.2-1041s1c1
Sequence:CCGGCCACAGAAGATTCTGGCATTTCTCGAGAAATGCCAGAATCTTCTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001518.2-855s1c1
Sequence:CCGGCCGAGAACTATGATCTTGCAACTCGAGTTGCAAGATCATAGTTCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001518.2-671s1c1
Sequence:CCGGCGGATGAGTGTAGATGCTGTACTCGAGTACAGCATCTACACTCATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001518.2-1181s1c1
Sequence:CCGGCCAGCAGAAGATGATGATTATCTCGAGATAATCATCATCTTCTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-959s21c1
Sequence:CCGGGGTCGTGTGATGGTAACAGATCTCGAGATCTGTTACCATCACACGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-1070s21c1
Sequence:CCGGATGGCAGCTGTGACAGTAAAGCTCGAGCTTTACTGTCACAGCTGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-657s21c1
Sequence:CCGGCAACCCAGGCAAATCGGATGACTCGAGTCATCCGATTTGCCTGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001518.3-1182s21c1
Sequence:CCGGCAGCAGAAGATGATGATTATTCTCGAGAATAATCATCATCTTCTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-979s21c1
Sequence:CCGGTGCTGACAGGTCAATACTATCCTCGAGGATAGTATTGACCTGTCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-741s21c1
Sequence:CCGGATGGGAAAGCTTTAGGCAAATCTCGAGATTTGCCTAAAGCTTTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001518
VALIDATED
GTF2I MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIi
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001518.2-4070s1c1
Sequence:CCGGCGGCATTATTTCCTAGTTCTTCTCGAGAAGAACTAGGAAATAATGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001518.2-1041s1c1
Sequence:CCGGCCACAGAAGATTCTGGCATTTCTCGAGAAATGCCAGAATCTTCTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001518.2-855s1c1
Sequence:CCGGCCGAGAACTATGATCTTGCAACTCGAGTTGCAAGATCATAGTTCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001518.2-671s1c1
Sequence:CCGGCGGATGAGTGTAGATGCTGTACTCGAGTACAGCATCTACACTCATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001518.2-1181s1c1
Sequence:CCGGCCAGCAGAAGATGATGATTATCTCGAGATAATCATCATCTTCTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-959s21c1
Sequence:CCGGGGTCGTGTGATGGTAACAGATCTCGAGATCTGTTACCATCACACGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-1070s21c1
Sequence:CCGGATGGCAGCTGTGACAGTAAAGCTCGAGCTTTACTGTCACAGCTGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-657s21c1
Sequence:CCGGCAACCCAGGCAAATCGGATGACTCGAGTCATCCGATTTGCCTGGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001518.3-1182s21c1
Sequence:CCGGCAGCAGAAGATGATGATTATTCTCGAGAATAATCATCATCTTCTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-979s21c1
Sequence:CCGGTGCTGACAGGTCAATACTATCCTCGAGGATAGTATTGACCTGTCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_001518.3-741s21c1
Sequence:CCGGATGGGAAAGCTTTAGGCAAATCTCGAGATTTGCCTAAAGCTTTCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)