EMAIL THIS PAGE TO A FRIEND

GTF2IRD1

GTF2I repeat domain containing 1

178 Gene Product Result for
Synonyms: BEN CREAM1 GTF3 MUSTRD1 RBAP2 WBS WBSCR11 WBSCR12 hMusTRD1alpha1
Gene ID:
Human(9569) Summary: The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Mouse(57080) general transcription factor II I repeat domain-containing 1
Rat(246770) GTF2I repeat domain containing 1
Zebrafish(81597) GTF2I repeat domain-containing 1
chicken(417487) GTF2I repeat domain containing 1
dog(489796) GTF2I repeat domain containing 1
cow(507792) GTF2I repeat domain containing 1
domestic cat(101094811) GTF2I repeat domain containing 1
domestic guinea pig(100726332) GTF2I repeat domain containing 1
naked mole-rat(101724499) GTF2I repeat domain containing 1
sheep(101114076) GTF2I repeat domain containing 1
Domestic Rabbit(100340448) GTF2I repeat domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005685 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005685 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005685 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020331 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020331 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020331 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043171 MISSION® esiRNA esiRNA human GTF2IRD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005685 Rosetta Predictions human pricing
NM_016328 Rosetta Predictions human pricing
NM_001001504 Rosetta Predictions rat pricing
XM_579050 Rosetta Predictions rat pricing
NM_001081462 Rosetta Predictions mouse pricing
NM_001081463 Rosetta Predictions mouse pricing
NM_001081464 Rosetta Predictions mouse pricing
NM_001081465 Rosetta Predictions mouse pricing
NM_001081466 Rosetta Predictions mouse pricing
NM_001081467 Rosetta Predictions mouse pricing
NM_001081468 Rosetta Predictions mouse pricing
NM_001081469 Rosetta Predictions mouse pricing
NM_001081470 Rosetta Predictions mouse pricing
NM_020331 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179490 predicted 1342
2 SASI_Hs01_00179491 predicted 1040
3 SASI_Hs01_00179492 predicted 301
4 SASI_Hs01_00179493 predicted 475
5 SASI_Hs01_00179494 predicted 1469
6 SASI_Hs01_00179495 predicted 2318
7 SASI_Hs01_00179496 predicted 1031
8 SASI_Hs01_00179497 predicted 2504
9 SASI_Hs01_00179498 predicted 2285
10 SASI_Hs01_00179499 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026157 predicted 1658
2 SASI_Hs01_00026158 predicted 1350
3 SASI_Hs01_00026159 predicted 617
4 SASI_Hs01_00026160 predicted 792
5 SASI_Hs01_00026161 predicted 1786
6 SASI_Hs01_00026162 predicted 2677
7 SASI_Hs01_00026163 predicted 1347
8 SASI_Hs01_00026164 predicted 2872
9 SASI_Hs01_00026165 predicted 2647
10 SASI_Hs01_00026166 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039273 predicted 1715
2 SASI_Rn01_00039274 predicted 793
3 SASI_Rn01_00039275 predicted 1611
4 SASI_Rn01_00039276 predicted 549
5 SASI_Rn01_00039277 predicted 544
6 SASI_Rn01_00039278 predicted 230
7 SASI_Rn01_00039279 predicted 2036
8 SASI_Rn01_00039280 predicted 544
9 SASI_Rn01_00039281 predicted 1353
10 SASI_Rn01_00039282 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154174 predicted 1610
2 SASI_Rn01_00154175 predicted 1691
3 SASI_Rn01_00154176 predicted 2386
4 SASI_Rn01_00154177 predicted 2182
5 SASI_Rn01_00154178 predicted 2222
6 SASI_Rn01_00154179 predicted 1698
7 SASI_Rn01_00154180 predicted 2206
8 SASI_Rn01_00154181 predicted 2196
9 SASI_Rn01_00154182 predicted 240
10 SASI_Rn01_00154183 predicted 1207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081462 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298476 predicted 1274
2 SASI_Mm02_00298477 predicted 1669
3 SASI_Mm02_00298478 predicted 1834
4 SASI_Mm02_00298479 predicted 784
5 SASI_Mm02_00298480 predicted 760
6 SASI_Mm02_00298481 predicted 600
7 SASI_Mm02_00298482 predicted 1101
8 SASI_Mm02_00298483 predicted 1230
9 SASI_Mm02_00298484 predicted 1809
10 SASI_Mm02_00298485 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081463 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298486 predicted 1272
2 SASI_Mm02_00298487 predicted 1666
3 SASI_Mm02_00298488 predicted 1832
4 SASI_Mm02_00298489 predicted 791
5 SASI_Mm02_00298490 predicted 753
6 SASI_Mm02_00298491 predicted 606
7 SASI_Mm02_00298492 predicted 1094
8 SASI_Mm02_00298493 predicted 1237
9 SASI_Mm02_00298494 predicted 1812
10 SASI_Mm02_00298495 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298496 predicted 1267
2 SASI_Mm02_00298497 predicted 1670
3 SASI_Mm02_00298498 predicted 1830
4 SASI_Mm02_00298499 predicted 785
5 SASI_Mm02_00298500 predicted 755
6 SASI_Mm02_00298501 predicted 607
7 SASI_Mm02_00298502 predicted 1098
8 SASI_Mm02_00298503 predicted 1228
9 SASI_Mm02_00298504 predicted 1810
10 SASI_Mm02_00298505 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298506 predicted 1220
2 SASI_Mm02_00298507 predicted 1612
3 SASI_Mm02_00298508 predicted 1785
4 SASI_Mm02_00298509 predicted 732
5 SASI_Mm02_00298510 predicted 707
6 SASI_Mm02_00298511 predicted 550
7 SASI_Mm02_00298512 predicted 1046
8 SASI_Mm02_00298513 predicted 1177
9 SASI_Mm02_00298514 predicted 1757
10 SASI_Mm02_00298515 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298516 predicted 1271
2 SASI_Mm02_00298517 predicted 1668
3 SASI_Mm02_00298518 predicted 1828
4 SASI_Mm02_00298519 predicted 784
5 SASI_Mm02_00298520 predicted 761
6 SASI_Mm02_00298521 predicted 603
7 SASI_Mm02_00298522 predicted 1101
8 SASI_Mm02_00298523 predicted 1233
9 SASI_Mm02_00298524 predicted 1805
10 SASI_Mm02_00298525 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298526 predicted 1269
2 SASI_Mm02_00298527 predicted 1673
3 SASI_Mm02_00298528 predicted 1833
4 SASI_Mm02_00298529 predicted 783
5 SASI_Mm02_00298530 predicted 753
6 SASI_Mm02_00298531 predicted 607
7 SASI_Mm02_00298532 predicted 1097
8 SASI_Mm02_00298533 predicted 1233
9 SASI_Mm02_00298534 predicted 1808
10 SASI_Mm02_00298535 predicted 650
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298536 predicted 1269
2 SASI_Mm02_00298537 predicted 1673
3 SASI_Mm02_00298538 predicted 1831
4 SASI_Mm02_00298539 predicted 789
5 SASI_Mm02_00298540 predicted 756
6 SASI_Mm02_00298541 predicted 606
7 SASI_Mm02_00298542 predicted 1096
8 SASI_Mm02_00298543 predicted 1230
9 SASI_Mm02_00298544 predicted 1813
10 SASI_Mm02_00298545 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081469 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298546 predicted 1270
2 SASI_Mm02_00298547 predicted 1671
3 SASI_Mm02_00298548 predicted 1833
4 SASI_Mm02_00298549 predicted 786
5 SASI_Mm02_00298550 predicted 759
6 SASI_Mm02_00298551 predicted 600
7 SASI_Mm02_00298552 predicted 1098
8 SASI_Mm02_00298553 predicted 1229
9 SASI_Mm02_00298554 predicted 1813
10 SASI_Mm02_00298555 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081470 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298556 predicted 1272
2 SASI_Mm02_00298557 predicted 1673
3 SASI_Mm02_00298558 predicted 1835
4 SASI_Mm02_00298559 predicted 783
5 SASI_Mm02_00298560 predicted 756
6 SASI_Mm02_00298561 predicted 601
7 SASI_Mm02_00298562 predicted 1097
8 SASI_Mm02_00298563 predicted 1228
9 SASI_Mm02_00298564 predicted 1809
10 SASI_Mm02_00298565 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020331 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325527 predicted 1265
2 SASI_Mm01_00062005 predicted 1664
3 SASI_Mm02_00325528 predicted 1829
4 SASI_Mm02_00325529 predicted 785
5 SASI_Mm01_00062008 predicted 753
6 SASI_Mm01_00062009 predicted 607
7 SASI_Mm02_00325530 predicted 1095
8 SASI_Mm02_00325531 predicted 1230
9 SASI_Mm02_00325532 predicted 1807
10 SASI_Mm02_00325533 predicted 651
11 SASI_Mm01_00062006 predicted 1654
12 SASI_Mm01_00062007 predicted 846
13 SASI_Mm01_00062010 predicted 1814
14 SASI_Mm01_00062011 predicted 1914
15 SASI_Mm01_00062012 predicted 963
16 SASI_Mm01_00062013 predicted 1544
17 SASI_Mm01_00062014 predicted 2911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005685
VALIDATED
GTF2IRD1 MISSION shRNA Bacterial Glycerol Stock
GTF2I repeat domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005685.2-1350s21c1
Sequence:CCGGGGATGTTTGATGAGCGAATTTCTCGAGAAATTCGCTCATCAAACATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005685.2-475s21c1
Sequence:GTACCGGGGAGGTGTTTGATGTTCTTTACTCGAGTAAAGAACATCAAACACCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005685.2-2451s21c1
Sequence:GTACCGGAGGAACTCTTCAACGAGAAATCTCGAGATTTCTCGTTGAAGAGTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005685.2-2918s21c1
Sequence:CCGGGTACTGAATCAGGACCTCACTCTCGAGAGTGAGGTCCTGATTCAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005685.2-2498s21c1
Sequence:CCGGCCGGTGCTGGTCCCTTATAAACTCGAGTTTATAAGGGACCAGCACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005685.2-2849s1c1
Sequence:CCGGCCAATGTACATGGTGGACTATCTCGAGATAGTCCACCATGTACATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005685.2-2918s1c1
Sequence:CCGGGTACTGAATCAGGACCTCACTCTCGAGAGTGAGGTCCTGATTCAGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005685.2-1321s1c1
Sequence:CCGGGCGCCATAGTATCCACTTCATCTCGAGATGAAGTGGATACTATGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005685.2-2669s1c1
Sequence:CCGGCCCTTTGCAGAAATCTGCAATCTCGAGATTGCAGATTTCTGCAAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005685.2-1333s1c1
Sequence:CCGGCCACTTCATCATTAAGAGGATCTCGAGATCCTCTTAATGATGAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005685
VALIDATED
GTF2IRD1 MISSION shRNA shRNA Plasmid DNA
GTF2I repeat domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005685.2-1350s21c1
Sequence:CCGGGGATGTTTGATGAGCGAATTTCTCGAGAAATTCGCTCATCAAACATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005685.2-475s21c1
Sequence:GTACCGGGGAGGTGTTTGATGTTCTTTACTCGAGTAAAGAACATCAAACACCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005685.2-2451s21c1
Sequence:GTACCGGAGGAACTCTTCAACGAGAAATCTCGAGATTTCTCGTTGAAGAGTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005685.2-2918s21c1
Sequence:CCGGGTACTGAATCAGGACCTCACTCTCGAGAGTGAGGTCCTGATTCAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005685.2-2498s21c1
Sequence:CCGGCCGGTGCTGGTCCCTTATAAACTCGAGTTTATAAGGGACCAGCACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005685.2-2849s1c1
Sequence:CCGGCCAATGTACATGGTGGACTATCTCGAGATAGTCCACCATGTACATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005685.2-2918s1c1
Sequence:CCGGGTACTGAATCAGGACCTCACTCTCGAGAGTGAGGTCCTGATTCAGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005685.2-1321s1c1
Sequence:CCGGGCGCCATAGTATCCACTTCATCTCGAGATGAAGTGGATACTATGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005685.2-2669s1c1
Sequence:CCGGCCCTTTGCAGAAATCTGCAATCTCGAGATTGCAGATTTCTGCAAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005685.2-1333s1c1
Sequence:CCGGCCACTTCATCATTAAGAGGATCTCGAGATCCTCTTAATGATGAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005685
VALIDATED
GTF2IRD1 MISSION shRNA Lentiviral Transduction Particles
GTF2I repeat domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005685.2-1350s21c1
Sequence:CCGGGGATGTTTGATGAGCGAATTTCTCGAGAAATTCGCTCATCAAACATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005685.2-475s21c1
Sequence:GTACCGGGGAGGTGTTTGATGTTCTTTACTCGAGTAAAGAACATCAAACACCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005685.2-2451s21c1
Sequence:GTACCGGAGGAACTCTTCAACGAGAAATCTCGAGATTTCTCGTTGAAGAGTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005685.2-2918s21c1
Sequence:CCGGGTACTGAATCAGGACCTCACTCTCGAGAGTGAGGTCCTGATTCAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005685.2-2498s21c1
Sequence:CCGGCCGGTGCTGGTCCCTTATAAACTCGAGTTTATAAGGGACCAGCACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005685.2-2849s1c1
Sequence:CCGGCCAATGTACATGGTGGACTATCTCGAGATAGTCCACCATGTACATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005685.2-2918s1c1
Sequence:CCGGGTACTGAATCAGGACCTCACTCTCGAGAGTGAGGTCCTGATTCAGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005685.2-1321s1c1
Sequence:CCGGGCGCCATAGTATCCACTTCATCTCGAGATGAAGTGGATACTATGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005685.2-2669s1c1
Sequence:CCGGCCCTTTGCAGAAATCTGCAATCTCGAGATTGCAGATTTCTGCAAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005685.2-1333s1c1
Sequence:CCGGCCACTTCATCATTAAGAGGATCTCGAGATCCTCTTAATGATGAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020331
VALIDATED
GTF2IRD1 MISSION shRNA Bacterial Glycerol Stock
GTF2I repeat domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000226279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020331.2-495s21c1
Sequence:CCGGCCAGAAGCAGGACACCCTAAACTCGAGTTTAGGGTGTCCTGCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020331.2-2317s21c1
Sequence:CCGGGTGAAGCTCTGGGCATCAAATCTCGAGATTTGATGCCCAGAGCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020331.2-1920s21c1
Sequence:GTACCGGATGCTGTTCAACACGAAATATCTCGAGATATTTCGTGTTGAACAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020331.2-2374s21c1
Sequence:CCGGACCCAGGCTCGGTAATCATTGCTCGAGCAATGATTACCGAGCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020331.2-1788s21c1
Sequence:CCGGCCCTCAGAGGATTCCGGTTATCTCGAGATAACCGGAATCCTCTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020331.1-1341s1c1
Sequence:CCGGGCTGTGGAAATTGTGGGTATTCTCGAGAATACCCACAATTTCCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020331.1-2325s1c1
Sequence:CCGGGTGCCCTACAAGAGAATCAAACTCGAGTTTGATTCTCTTGTAGGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020331.1-3342s1c1
Sequence:CCGGCCAGTGTACATGGTGGACTATCTCGAGATAGTCCACCATGTACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020331.1-1893s1c1
Sequence:CCGGGAGATGCTGTTCAACACGAAACTCGAGTTTCGTGTTGAACAGCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020331.1-1175s1c1
Sequence:CCGGCGTCCATGACAAGTCAGAGAACTCGAGTTCTCTGACTTGTCATGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020331
VALIDATED
GTF2IRD1 MISSION shRNA shRNA Plasmid DNA
GTF2I repeat domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000226279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020331.2-495s21c1
Sequence:CCGGCCAGAAGCAGGACACCCTAAACTCGAGTTTAGGGTGTCCTGCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020331.2-2317s21c1
Sequence:CCGGGTGAAGCTCTGGGCATCAAATCTCGAGATTTGATGCCCAGAGCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020331.2-1920s21c1
Sequence:GTACCGGATGCTGTTCAACACGAAATATCTCGAGATATTTCGTGTTGAACAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020331.2-2374s21c1
Sequence:CCGGACCCAGGCTCGGTAATCATTGCTCGAGCAATGATTACCGAGCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020331.2-1788s21c1
Sequence:CCGGCCCTCAGAGGATTCCGGTTATCTCGAGATAACCGGAATCCTCTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020331.1-1341s1c1
Sequence:CCGGGCTGTGGAAATTGTGGGTATTCTCGAGAATACCCACAATTTCCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020331.1-2325s1c1
Sequence:CCGGGTGCCCTACAAGAGAATCAAACTCGAGTTTGATTCTCTTGTAGGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020331.1-3342s1c1
Sequence:CCGGCCAGTGTACATGGTGGACTATCTCGAGATAGTCCACCATGTACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020331.1-1893s1c1
Sequence:CCGGGAGATGCTGTTCAACACGAAACTCGAGTTTCGTGTTGAACAGCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020331.1-1175s1c1
Sequence:CCGGCGTCCATGACAAGTCAGAGAACTCGAGTTCTCTGACTTGTCATGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020331
VALIDATED
GTF2IRD1 MISSION shRNA Lentiviral Transduction Particles
GTF2I repeat domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000226279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020331.2-495s21c1
Sequence:CCGGCCAGAAGCAGGACACCCTAAACTCGAGTTTAGGGTGTCCTGCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020331.2-2317s21c1
Sequence:CCGGGTGAAGCTCTGGGCATCAAATCTCGAGATTTGATGCCCAGAGCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020331.2-1920s21c1
Sequence:GTACCGGATGCTGTTCAACACGAAATATCTCGAGATATTTCGTGTTGAACAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020331.2-2374s21c1
Sequence:CCGGACCCAGGCTCGGTAATCATTGCTCGAGCAATGATTACCGAGCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020331.2-1788s21c1
Sequence:CCGGCCCTCAGAGGATTCCGGTTATCTCGAGATAACCGGAATCCTCTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020331.1-1341s1c1
Sequence:CCGGGCTGTGGAAATTGTGGGTATTCTCGAGAATACCCACAATTTCCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020331.1-2325s1c1
Sequence:CCGGGTGCCCTACAAGAGAATCAAACTCGAGTTTGATTCTCTTGTAGGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020331.1-3342s1c1
Sequence:CCGGCCAGTGTACATGGTGGACTATCTCGAGATAGTCCACCATGTACACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020331.1-1893s1c1
Sequence:CCGGGAGATGCTGTTCAACACGAAACTCGAGTTTCGTGTTGAACAGCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020331.1-1175s1c1
Sequence:CCGGCGTCCATGACAAGTCAGAGAACTCGAGTTCTCTGACTTGTCATGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)