EMAIL THIS PAGE TO A FRIEND

GTF2IRD2

GTF2I repeat domain containing 2

49 Gene Product Result for
Synonyms: FP630 GTF2IRD2 alpha GTF2IRD2A
Gene ID:
Human(84163) Summary: This gene is unusual in that its coding sequence is mostly derived from Charlie8 repeat elements. However, there is mRNA and EST evidence to suggest that this gene is transcribed, and the encoded protein has a homolog in mouse, with which it shares 78% sequence identity. The exact function of this gene product is not known. It is inferred to be a transcription factor based on the presence of GTF2I-like repeats (containing helix-loop-helix motifs), also found in other proteins such as GTF2IRD1 and GTF2I. These three genes are clustered together on chr 7q11.23. [provided by RefSeq, Jul 2008]
Mouse(114674) GTF2I repeat domain containing 2
Rat(288606) GTF2I repeat domain containing 2
dog(607692) GTF2I repeat domain containing 2
cow(539745) GTF2I repeat domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173537 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053266 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053266 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053266 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032203 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173537 Rosetta Predictions human pricing
XM_213757 Rosetta Predictions rat pricing
NM_053266 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195153 predicted 1160
2 SASI_Hs01_00195154 predicted 786
3 SASI_Hs01_00195156 predicted 846
4 SASI_Hs01_00195158 predicted 893
5 SASI_Hs01_00195159 predicted 947
6 SASI_Hs01_00195160 predicted 907
7 SASI_Hs01_00195162 predicted 1108
8 SASI_Hs02_00368330 predicted 950
9 SASI_Hs02_00368331 predicted 535
10 SASI_Hs01_00195155 predicted 699
11 SASI_Hs01_00195157 predicted 671
12 SASI_Hs01_00195161 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156440 predicted 387
2 SASI_Rn01_00156441 predicted 203
3 SASI_Rn01_00156442 predicted 257
4 SASI_Rn01_00156443 predicted 258
5 SASI_Rn01_00156444 predicted 195
6 SASI_Rn01_00156445 predicted 389
7 SASI_Rn01_00156446 predicted 388
8 SASI_Rn01_00156447 predicted 249
9 SASI_Rn01_00156448 predicted 401
10 SASI_Rn02_00374895 predicted 450
11 SASI_Rn01_00156449 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053266 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126283 predicted 1966
2 SASI_Mm01_00126284 predicted 1433
3 SASI_Mm01_00126287 predicted 865
4 SASI_Mm01_00126288 predicted 2382
5 SASI_Mm01_00126289 predicted 2161
6 SASI_Mm01_00126290 predicted 932
7 SASI_Mm01_00126291 predicted 2005
8 SASI_Mm01_00126292 predicted 836
9 SASI_Mm02_00337913 predicted 870
10 SASI_Mm02_00337914 predicted 2474
11 SASI_Mm01_00126285 predicted 556
12 SASI_Mm01_00126286 predicted 1122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173537
GTF2IRD2 MISSION shRNA Bacterial Glycerol Stock
GTF2I repeat domain containing 2
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000435626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173537.2-1836s21c1
Sequence:CCGGTCGATGAGATCACGGATATAACTCGAGTTATATCCGTGATCTCATCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173537.2-3266s21c1
Sequence:CCGGGCCACCATGCCTGGCTAATTTCTCGAGAAATTAGCCAGGCATGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173537.2-482s21c1
Sequence:CCGGCACTCGGGCGAAACGGAAATACTCGAGTATTTCCGTTTCGCCCGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173537
GTF2IRD2 MISSION shRNA shRNA Plasmid DNA
GTF2I repeat domain containing 2
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000435626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173537.2-1836s21c1
Sequence:CCGGTCGATGAGATCACGGATATAACTCGAGTTATATCCGTGATCTCATCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173537.2-3266s21c1
Sequence:CCGGGCCACCATGCCTGGCTAATTTCTCGAGAAATTAGCCAGGCATGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173537.2-482s21c1
Sequence:CCGGCACTCGGGCGAAACGGAAATACTCGAGTATTTCCGTTTCGCCCGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173537
GTF2IRD2 MISSION shRNA Lentiviral Transduction Particles
GTF2I repeat domain containing 2
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000435626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173537.2-1836s21c1
Sequence:CCGGTCGATGAGATCACGGATATAACTCGAGTTATATCCGTGATCTCATCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173537.2-3266s21c1
Sequence:CCGGGCCACCATGCCTGGCTAATTTCTCGAGAAATTAGCCAGGCATGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173537.2-482s21c1
Sequence:CCGGCACTCGGGCGAAACGGAAATACTCGAGTATTTCCGTTTCGCCCGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053266
VALIDATED
GTF2IRD2 MISSION shRNA Bacterial Glycerol Stock
GTF2I repeat domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053266.1-2665s21c1
Sequence:CCGGGCTCAACTACATCCCTAAGATCTCGAGATCTTAGGGATGTAGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053266.1-3205s1c1
Sequence:CCGGCCTAGAATGTTCCAGACCTAACTCGAGTTAGGTCTGGAACATTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053266.1-924s21c1
Sequence:CCGGCGGAGTCGGAAGATCCTAATTCTCGAGAATTAGGATCTTCCGACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053266.1-1861s21c1
Sequence:CCGGCGATGAGATTACGGATATCAACTCGAGTTGATATCCGTAATCTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053266.1-924s1c1
Sequence:CCGGCGGAGTCGGAAGATCCTAATTCTCGAGAATTAGGATCTTCCGACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053266.1-2665s1c1
Sequence:CCGGGCTCAACTACATCCCTAAGATCTCGAGATCTTAGGGATGTAGTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053266.1-565s1c1
Sequence:CCGGCCTCTGTTACCGTAAAGCCTTCTCGAGAAGGCTTTACGGTAACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053266.1-1861s1c1
Sequence:CCGGCGATGAGATTACGGATATCAACTCGAGTTGATATCCGTAATCTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053266.1-3205s21c1
Sequence:CCGGCCTAGAATGTTCCAGACCTAACTCGAGTTAGGTCTGGAACATTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053266.1-565s21c1
Sequence:CCGGCCTCTGTTACCGTAAAGCCTTCTCGAGAAGGCTTTACGGTAACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053266
VALIDATED
GTF2IRD2 MISSION shRNA shRNA Plasmid DNA
GTF2I repeat domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053266.1-2665s21c1
Sequence:CCGGGCTCAACTACATCCCTAAGATCTCGAGATCTTAGGGATGTAGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053266.1-3205s1c1
Sequence:CCGGCCTAGAATGTTCCAGACCTAACTCGAGTTAGGTCTGGAACATTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053266.1-924s21c1
Sequence:CCGGCGGAGTCGGAAGATCCTAATTCTCGAGAATTAGGATCTTCCGACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053266.1-1861s21c1
Sequence:CCGGCGATGAGATTACGGATATCAACTCGAGTTGATATCCGTAATCTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053266.1-924s1c1
Sequence:CCGGCGGAGTCGGAAGATCCTAATTCTCGAGAATTAGGATCTTCCGACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053266.1-2665s1c1
Sequence:CCGGGCTCAACTACATCCCTAAGATCTCGAGATCTTAGGGATGTAGTTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053266.1-565s1c1
Sequence:CCGGCCTCTGTTACCGTAAAGCCTTCTCGAGAAGGCTTTACGGTAACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053266.1-1861s1c1
Sequence:CCGGCGATGAGATTACGGATATCAACTCGAGTTGATATCCGTAATCTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053266.1-3205s21c1
Sequence:CCGGCCTAGAATGTTCCAGACCTAACTCGAGTTAGGTCTGGAACATTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053266.1-565s21c1
Sequence:CCGGCCTCTGTTACCGTAAAGCCTTCTCGAGAAGGCTTTACGGTAACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053266
VALIDATED
GTF2IRD2 MISSION shRNA Lentiviral Transduction Particles
GTF2I repeat domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053266.1-2665s21c1
Sequence:CCGGGCTCAACTACATCCCTAAGATCTCGAGATCTTAGGGATGTAGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053266.1-3205s1c1
Sequence:CCGGCCTAGAATGTTCCAGACCTAACTCGAGTTAGGTCTGGAACATTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053266.1-924s21c1
Sequence:CCGGCGGAGTCGGAAGATCCTAATTCTCGAGAATTAGGATCTTCCGACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053266.1-1861s21c1
Sequence:CCGGCGATGAGATTACGGATATCAACTCGAGTTGATATCCGTAATCTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053266.1-924s1c1
Sequence:CCGGCGGAGTCGGAAGATCCTAATTCTCGAGAATTAGGATCTTCCGACTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053266.1-2665s1c1
Sequence:CCGGGCTCAACTACATCCCTAAGATCTCGAGATCTTAGGGATGTAGTTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053266.1-565s1c1
Sequence:CCGGCCTCTGTTACCGTAAAGCCTTCTCGAGAAGGCTTTACGGTAACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053266.1-1861s1c1
Sequence:CCGGCGATGAGATTACGGATATCAACTCGAGTTGATATCCGTAATCTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053266.1-3205s21c1
Sequence:CCGGCCTAGAATGTTCCAGACCTAACTCGAGTTAGGTCTGGAACATTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053266.1-565s21c1
Sequence:CCGGCCTCTGTTACCGTAAAGCCTTCTCGAGAAGGCTTTACGGTAACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032203
GTF2IRD2 MISSION shRNA Bacterial Glycerol Stock
GTF2I repeat domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-1389s1c1
Sequence:CCGGGCTGTCTGATTTCAAACTCTACTCGAGTAGAGTTTGAAATCAGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-996s1c1
Sequence:CCGGCCTGTACTACACGGAGATTAACTCGAGTTAATCTCCGTGTAGTACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-1304s1c1
Sequence:CCGGCCCTGAAATTGGCTTCCAGAACTCGAGTTCTGGAAGCCAATTTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-673s1c1
Sequence:CCGGCGTGTTGAGAAGAGCCTGAAACTCGAGTTTCAGGCTCTTCTCAACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-293s1c1
Sequence:CCGGGCAAGCATTATGACCAGTATACTCGAGTATACTGGTCATAATGCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032203
GTF2IRD2 MISSION shRNA shRNA Plasmid DNA
GTF2I repeat domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-1389s1c1
Sequence:CCGGGCTGTCTGATTTCAAACTCTACTCGAGTAGAGTTTGAAATCAGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-996s1c1
Sequence:CCGGCCTGTACTACACGGAGATTAACTCGAGTTAATCTCCGTGTAGTACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-1304s1c1
Sequence:CCGGCCCTGAAATTGGCTTCCAGAACTCGAGTTCTGGAAGCCAATTTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-673s1c1
Sequence:CCGGCGTGTTGAGAAGAGCCTGAAACTCGAGTTTCAGGCTCTTCTCAACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-293s1c1
Sequence:CCGGGCAAGCATTATGACCAGTATACTCGAGTATACTGGTCATAATGCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032203
GTF2IRD2 MISSION shRNA Lentiviral Transduction Particles
GTF2I repeat domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-1389s1c1
Sequence:CCGGGCTGTCTGATTTCAAACTCTACTCGAGTAGAGTTTGAAATCAGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-996s1c1
Sequence:CCGGCCTGTACTACACGGAGATTAACTCGAGTTAATCTCCGTGTAGTACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-1304s1c1
Sequence:CCGGCCCTGAAATTGGCTTCCAGAACTCGAGTTCTGGAAGCCAATTTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-673s1c1
Sequence:CCGGCGTGTTGAGAAGAGCCTGAAACTCGAGTTTCAGGCTCTTCTCAACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032203.3-293s1c1
Sequence:CCGGGCAAGCATTATGACCAGTATACTCGAGTATACTGGTCATAATGCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)