EMAIL THIS PAGE TO A FRIEND

GTF2IRD2B

GTF2I repeat domain containing 2B

21 Gene Product Result for
Species: Human GTF2IRD2B(389524), domestic guinea pig Gtf2ird2b(100725780), naked mole-rat Gtf2ird2b(101720606)
UniProtKB ID: Q6EKJ0, B2RNE9, Q69GU6, Q8N979, Q9H739
Gene ID:
Human(389524) Summary: This gene encodes a glycosylated phosphoprotein with a leucine zipper motif, two helix-loop-helix motifs (I repeats) that are similar to domains found in the TFII-I family of transcription factors, one CHARLIE8 transposable element-like sequence, and a BED zinc finger. This gene lies within a region that is deleted in Williams-Beuren syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
domestic guinea pig(100725780) GTF2I repeat domain containing 2B
naked mole-rat(101720606) GTF2I repeat domain containing 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003795 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148181 MISSION® esiRNA esiRNA human GTF2IRD2B (esiRNA2) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003795 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111298 predicted 1190
2 SASI_Hs01_00111299 predicted 820
3 SASI_Hs01_00111301 predicted 871
4 SASI_Hs01_00111303 predicted 926
5 SASI_Hs01_00111304 predicted 983
6 SASI_Hs01_00111305 predicted 939
7 SASI_Hs01_00111307 predicted 1140
8 SASI_Hs02_00304386 predicted 980
9 SASI_Hs02_00304387 predicted 570
10 SASI_Hs01_00111300 predicted 732
11 SASI_Hs01_00111302 predicted 695
12 SASI_Hs01_00111306 predicted 1129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003795
GTF2IRD2B MISSION shRNA Bacterial Glycerol Stock
GTF2I repeat domain containing 2B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003795.1-3305s1c1
Sequence:CCGGGAGATGAGGTTTCACCATGTTCTCGAGAACATGGTGAAACCTCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-1493s1c1
Sequence:CCGGGCGTATTTCTTCGTGGAAGTACTCGAGTACTTCCACGAAGAAATACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-659s1c1
Sequence:CCGGCCTGAGAATTACGACCTTGCACTCGAGTGCAAGGTCGTAATTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-275s1c1
Sequence:CCGGGCCCTCGAATCCATGTGTAAACTCGAGTTTACACATGGATTCGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003795.1-3187s1c1
Sequence:CCGGGATCTCGGCTTACTGCAACTTCTCGAGAAGTTGCAGTAAGCCGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-2613s1c1
Sequence:CCGGCCCTGAAATTGGTTTCCAGAACTCGAGTTCTGGAAACCAATTTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-2905s1c1
Sequence:CCGGCGCAAAGATTCTTTCCATGTTCTCGAGAACATGGAAAGAATCTTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-707s1c1
Sequence:CCGGGCAGGGATTTCATTCATCATACTCGAGTATGATGAATGAAATCCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-2904s1c1
Sequence:CCGGGCGCAAAGATTCTTTCCATGTCTCGAGACATGGAAAGAATCTTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003795
GTF2IRD2B MISSION shRNA shRNA Plasmid DNA
GTF2I repeat domain containing 2B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003795.1-3305s1c1
Sequence:CCGGGAGATGAGGTTTCACCATGTTCTCGAGAACATGGTGAAACCTCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-1493s1c1
Sequence:CCGGGCGTATTTCTTCGTGGAAGTACTCGAGTACTTCCACGAAGAAATACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-659s1c1
Sequence:CCGGCCTGAGAATTACGACCTTGCACTCGAGTGCAAGGTCGTAATTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-275s1c1
Sequence:CCGGGCCCTCGAATCCATGTGTAAACTCGAGTTTACACATGGATTCGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003795.1-3187s1c1
Sequence:CCGGGATCTCGGCTTACTGCAACTTCTCGAGAAGTTGCAGTAAGCCGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-2613s1c1
Sequence:CCGGCCCTGAAATTGGTTTCCAGAACTCGAGTTCTGGAAACCAATTTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-2905s1c1
Sequence:CCGGCGCAAAGATTCTTTCCATGTTCTCGAGAACATGGAAAGAATCTTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-707s1c1
Sequence:CCGGGCAGGGATTTCATTCATCATACTCGAGTATGATGAATGAAATCCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-2904s1c1
Sequence:CCGGGCGCAAAGATTCTTTCCATGTCTCGAGACATGGAAAGAATCTTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003795
GTF2IRD2B MISSION shRNA Lentiviral Transduction Particles
GTF2I repeat domain containing 2B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003795.1-3305s1c1
Sequence:CCGGGAGATGAGGTTTCACCATGTTCTCGAGAACATGGTGAAACCTCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-1493s1c1
Sequence:CCGGGCGTATTTCTTCGTGGAAGTACTCGAGTACTTCCACGAAGAAATACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-659s1c1
Sequence:CCGGCCTGAGAATTACGACCTTGCACTCGAGTGCAAGGTCGTAATTCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-275s1c1
Sequence:CCGGGCCCTCGAATCCATGTGTAAACTCGAGTTTACACATGGATTCGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157407    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003795.1-3187s1c1
Sequence:CCGGGATCTCGGCTTACTGCAACTTCTCGAGAAGTTGCAGTAAGCCGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-2613s1c1
Sequence:CCGGCCCTGAAATTGGTTTCCAGAACTCGAGTTCTGGAAACCAATTTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-2905s1c1
Sequence:CCGGCGCAAAGATTCTTTCCATGTTCTCGAGAACATGGAAAGAATCTTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-707s1c1
Sequence:CCGGGCAGGGATTTCATTCATCATACTCGAGTATGATGAATGAAATCCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003795.1-2904s1c1
Sequence:CCGGGCGCAAAGATTCTTTCCATGTCTCGAGACATGGAAAGAATCTTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)