EMAIL THIS PAGE TO A FRIEND

GTF3A

general transcription factor IIIA

63 Gene Product Result for
Synonyms: AP2 TFIIIA
UniProtKB ID: Q92664, B7ZBK5, Q12963, Q13097
Gene ID:
Human(2971) Summary: The product of this gene is a zinc finger protein with nine Cis[2]
Mouse(66596) general transcription factor III A
Rat(246299) general transcription factor III A
chicken(418931) general transcription factor IIIA
dog(477329) transcription factor IIIA-like
cow(100135054) general transcription factor IIIA
domestic cat(101097776) general transcription factor IIIA
domestic guinea pig(100730669) general transcription factor IIIA
naked mole-rat(101701748) general transcription factor IIIA
sheep(101113863) general transcription factor IIIA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025652 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025652 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025652 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002097 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002097 Rosetta Predictions human pricing
NM_001113570 Rosetta Predictions rat pricing
NM_025652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333192 predicted 972
2 SASI_Hs02_00333193 predicted 1153
3 SASI_Hs02_00333194 predicted 858
4 SASI_Hs02_00333195 predicted 1165
5 SASI_Hs02_00333196 predicted 481
6 SASI_Hs02_00333197 predicted 700
7 SASI_Hs02_00333198 predicted 490
8 SASI_Hs02_00333199 predicted 388
9 SASI_Hs02_00333200 predicted 960
10 SASI_Hs02_00333201 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251903 predicted 505
2 SASI_Rn02_00251904 predicted 445
3 SASI_Rn02_00251905 predicted 458
4 SASI_Rn02_00251906 predicted 727
5 SASI_Rn02_00251907 predicted 730
6 SASI_Rn02_00251908 predicted 810
7 SASI_Rn02_00251909 predicted 450
8 SASI_Rn02_00251910 predicted 626
9 SASI_Rn02_00251911 predicted 836
10 SASI_Rn02_00251912 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328768 predicted 416
2 SASI_Mm02_00328769 predicted 688
3 SASI_Mm02_00328770 predicted 313
4 SASI_Mm01_00111426 predicted 982
5 SASI_Mm01_00111427 predicted 785
6 SASI_Mm02_00328771 predicted 629
7 SASI_Mm01_00111430 predicted 799
8 SASI_Mm02_00328772 predicted 517
9 SASI_Mm02_00328773 predicted 473
10 SASI_Mm02_00328774 predicted 483
11 SASI_Mm01_00111423 predicted 737
12 SASI_Mm01_00111424 predicted 682
13 SASI_Mm01_00111425 predicted 914
14 SASI_Mm01_00111428 predicted 833
15 SASI_Mm01_00111429 predicted 919
16 SASI_Mm01_00111431 predicted 834
17 SASI_Mm01_00111432 predicted 670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025652
VALIDATED
GTF3A MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIA
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025652.1-696s1c1
Sequence:CCGGGAAGCCCATAAAGAGGACATACTCGAGTATGTCCTCTTTATGGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025652.1-914s1c1
Sequence:CCGGCTGTGGCAAGACATTCGCAATCTCGAGATTGCGAATGTCTTGCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025652.1-820s1c1
Sequence:CCGGGCTGCGGAAGAACCTACACAACTCGAGTTGTGTAGGTTCTTCCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025652.1-708s1c1
Sequence:CCGGGAGGACATAACCTGCAATGTACTCGAGTACATTGCAGGTTATGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025652.1-743s1c1
Sequence:CCGGCAAGCGCAGAGATTACCTTAACTCGAGTTAAGGTAATCTCTGCGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-796s21c1
Sequence:CCGGCAAGCGCAGAGATTACCTTAACTCGAGTTAAGGTAATCTCTGCGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-873s21c1
Sequence:CCGGGCTGCGGAAGAACCTACACAACTCGAGTTGTGTAGGTTCTTCCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-749s21c1
Sequence:CCGGGAAGCCCATAAAGAGGACATACTCGAGTATGTCCTCTTTATGGGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-967s21c1
Sequence:CCGGCTGTGGCAAGACATTCGCAATCTCGAGATTGCGAATGTCTTGCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-761s21c1
Sequence:CCGGGAGGACATAACCTGCAATGTACTCGAGTACATTGCAGGTTATGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025652
VALIDATED
GTF3A MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIA
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025652.1-696s1c1
Sequence:CCGGGAAGCCCATAAAGAGGACATACTCGAGTATGTCCTCTTTATGGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025652.1-914s1c1
Sequence:CCGGCTGTGGCAAGACATTCGCAATCTCGAGATTGCGAATGTCTTGCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025652.1-820s1c1
Sequence:CCGGGCTGCGGAAGAACCTACACAACTCGAGTTGTGTAGGTTCTTCCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025652.1-708s1c1
Sequence:CCGGGAGGACATAACCTGCAATGTACTCGAGTACATTGCAGGTTATGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025652.1-743s1c1
Sequence:CCGGCAAGCGCAGAGATTACCTTAACTCGAGTTAAGGTAATCTCTGCGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-796s21c1
Sequence:CCGGCAAGCGCAGAGATTACCTTAACTCGAGTTAAGGTAATCTCTGCGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-873s21c1
Sequence:CCGGGCTGCGGAAGAACCTACACAACTCGAGTTGTGTAGGTTCTTCCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-749s21c1
Sequence:CCGGGAAGCCCATAAAGAGGACATACTCGAGTATGTCCTCTTTATGGGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-967s21c1
Sequence:CCGGCTGTGGCAAGACATTCGCAATCTCGAGATTGCGAATGTCTTGCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-761s21c1
Sequence:CCGGGAGGACATAACCTGCAATGTACTCGAGTACATTGCAGGTTATGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025652
VALIDATED
GTF3A MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIA
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025652.1-696s1c1
Sequence:CCGGGAAGCCCATAAAGAGGACATACTCGAGTATGTCCTCTTTATGGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025652.1-914s1c1
Sequence:CCGGCTGTGGCAAGACATTCGCAATCTCGAGATTGCGAATGTCTTGCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025652.1-820s1c1
Sequence:CCGGGCTGCGGAAGAACCTACACAACTCGAGTTGTGTAGGTTCTTCCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025652.1-708s1c1
Sequence:CCGGGAGGACATAACCTGCAATGTACTCGAGTACATTGCAGGTTATGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025652.1-743s1c1
Sequence:CCGGCAAGCGCAGAGATTACCTTAACTCGAGTTAAGGTAATCTCTGCGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-796s21c1
Sequence:CCGGCAAGCGCAGAGATTACCTTAACTCGAGTTAAGGTAATCTCTGCGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-873s21c1
Sequence:CCGGGCTGCGGAAGAACCTACACAACTCGAGTTGTGTAGGTTCTTCCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-749s21c1
Sequence:CCGGGAAGCCCATAAAGAGGACATACTCGAGTATGTCCTCTTTATGGGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-967s21c1
Sequence:CCGGCTGTGGCAAGACATTCGCAATCTCGAGATTGCGAATGTCTTGCCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025652.3-761s21c1
Sequence:CCGGGAGGACATAACCTGCAATGTACTCGAGTACATTGCAGGTTATGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002097
VALIDATED
GTF3A MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIA
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002097.1-488s1c1
Sequence:CCGGCCGTTTGTTTGTGCAGCCAATCTCGAGATTGGCTGCACAAACAAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002097.1-875s1c1
Sequence:CCGGCGCAAAGATTACCTTAAGCAACTCGAGTTGCTTAAGGTAATCTTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002097.1-1158s1c1
Sequence:CCGGGCCTCTCATCTCAGTGGATATCTCGAGATATCCACTGAGATGAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002097.1-982s1c1
Sequence:CCGGCCAAAGCCATATCCTCTCCTTCTCGAGAAGGAGAGGATATGGCTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002097.1-602s1c1
Sequence:CCGGGAAGACTGTAAGAAGACCTTTCTCGAGAAAGGTCTTCTTACAGTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002097.2-1158s21c1
Sequence:CCGGGCCTCTCATCTCAGTGGATATCTCGAGATATCCACTGAGATGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002097.2-659s21c1
Sequence:CCGGGCATACCAATGAACCTCTATTCTCGAGAATAGAGGTTCATTGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002097.2-817s21c1
Sequence:CCGGATGTGAGAGAAACCCATAAAGCTCGAGCTTTATGGGTTTCTCTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002097.2-603s21c1
Sequence:CCGGGAAGACTGTAAGAAGACCTTTCTCGAGAAAGGTCTTCTTACAGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002097.2-876s21c1
Sequence:CCGGCGCAAAGATTACCTTAAGCAACTCGAGTTGCTTAAGGTAATCTTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002097
VALIDATED
GTF3A MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002097.1-488s1c1
Sequence:CCGGCCGTTTGTTTGTGCAGCCAATCTCGAGATTGGCTGCACAAACAAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002097.1-875s1c1
Sequence:CCGGCGCAAAGATTACCTTAAGCAACTCGAGTTGCTTAAGGTAATCTTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002097.1-1158s1c1
Sequence:CCGGGCCTCTCATCTCAGTGGATATCTCGAGATATCCACTGAGATGAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002097.1-982s1c1
Sequence:CCGGCCAAAGCCATATCCTCTCCTTCTCGAGAAGGAGAGGATATGGCTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002097.1-602s1c1
Sequence:CCGGGAAGACTGTAAGAAGACCTTTCTCGAGAAAGGTCTTCTTACAGTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002097.2-1158s21c1
Sequence:CCGGGCCTCTCATCTCAGTGGATATCTCGAGATATCCACTGAGATGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002097.2-659s21c1
Sequence:CCGGGCATACCAATGAACCTCTATTCTCGAGAATAGAGGTTCATTGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002097.2-817s21c1
Sequence:CCGGATGTGAGAGAAACCCATAAAGCTCGAGCTTTATGGGTTTCTCTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002097.2-603s21c1
Sequence:CCGGGAAGACTGTAAGAAGACCTTTCTCGAGAAAGGTCTTCTTACAGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002097.2-876s21c1
Sequence:CCGGCGCAAAGATTACCTTAAGCAACTCGAGTTGCTTAAGGTAATCTTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002097
VALIDATED
GTF3A MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIA
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_002097.1-488s1c1
Sequence:CCGGCCGTTTGTTTGTGCAGCCAATCTCGAGATTGGCTGCACAAACAAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002097.1-875s1c1
Sequence:CCGGCGCAAAGATTACCTTAAGCAACTCGAGTTGCTTAAGGTAATCTTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002097.1-1158s1c1
Sequence:CCGGGCCTCTCATCTCAGTGGATATCTCGAGATATCCACTGAGATGAGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_002097.1-982s1c1
Sequence:CCGGCCAAAGCCATATCCTCTCCTTCTCGAGAAGGAGAGGATATGGCTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002097.1-602s1c1
Sequence:CCGGGAAGACTGTAAGAAGACCTTTCTCGAGAAAGGTCTTCTTACAGTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002097.2-1158s21c1
Sequence:CCGGGCCTCTCATCTCAGTGGATATCTCGAGATATCCACTGAGATGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002097.2-659s21c1
Sequence:CCGGGCATACCAATGAACCTCTATTCTCGAGAATAGAGGTTCATTGGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002097.2-817s21c1
Sequence:CCGGATGTGAGAGAAACCCATAAAGCTCGAGCTTTATGGGTTTCTCTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002097.2-603s21c1
Sequence:CCGGGAAGACTGTAAGAAGACCTTTCTCGAGAAAGGTCTTCTTACAGTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002097.2-876s21c1
Sequence:CCGGCGCAAAGATTACCTTAAGCAACTCGAGTTGCTTAAGGTAATCTTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)