EMAIL THIS PAGE TO A FRIEND

GTF3C1

general transcription factor IIIC, polypeptide 1, alpha 220kDa

48 Gene Product Result for
Synonyms: TFIIIC TFIIIC220 TFIIICalpha
UniProtKB ID: Q12789, B2RP21, Q12838, Q6DKN9, Q9Y4W9
Gene ID:
Mouse(233863) general transcription factor III C 1
Rat(171063) general transcription factor IIIC, polypeptide 1, alpha
chicken(416646) general transcription factor IIIC, polypeptide 1, alpha 220kDa
domestic cat(101086440) general transcription factor IIIC, polypeptide 1, alpha 220kDa
cow(509874) general transcription factor IIIC, polypeptide 1, alpha 220kDa
dog(489956) general transcription factor IIIC, polypeptide 1, alpha 220kDa
sheep(101109667) general transcription factor IIIC, polypeptide 1, alpha 220kDa
Domestic Rabbit(100337975) general transcription factor IIIC, polypeptide 1, alpha 220kDa
domestic guinea pig(100722116) general transcription factor IIIC, polypeptide 1, alpha 220kDa
naked mole-rat(101705327) general transcription factor IIIC, polypeptide 1, alpha 220kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051617 Anti-GTF3C1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
PLA0180 Rabbit anti-GTF3C1/TFIIIC220 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human
immunohistochemistry, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001520 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001520 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001520 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_133826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_133826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_133826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001520 Rosetta Predictions human pricing
NM_133541 Rosetta Predictions rat pricing
NM_207239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198776 predicted 4115
2 SASI_Hs02_00332044 predicted 905
3 SASI_Hs01_00198779 predicted 4098
4 SASI_Hs01_00198780 predicted 3146
5 SASI_Hs02_00332045 predicted 753
6 SASI_Hs01_00198782 predicted 5043
7 SASI_Hs01_00198783 predicted 979
8 SASI_Hs01_00198784 predicted 2968
9 SASI_Hs01_00198785 predicted 4804
10 SASI_Hs02_00332046 predicted 2903
11 SASI_Hs01_00198777 predicted 4072
12 SASI_Hs01_00198778 predicted 3111
13 SASI_Hs01_00198781 predicted 3954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133541 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114439 predicted 2112
2 SASI_Rn02_00267729 predicted 5664
3 SASI_Rn01_00114440 predicted 411
4 SASI_Rn01_00114441 predicted 5654
5 SASI_Rn01_00114442 predicted 4040
6 SASI_Rn01_00114444 predicted 2969
7 SASI_Rn01_00114445 predicted 2634
8 SASI_Rn01_00114446 predicted 4761
9 SASI_Rn02_00267730 predicted 983
10 SASI_Rn01_00114447 predicted 6364
11 SASI_Rn01_00114443 predicted 5008
12 SASI_Rn01_00114448 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039881 predicted 5392
2 SASI_Mm02_00351965 predicted 3113
3 SASI_Mm01_00039882 predicted 4058
4 SASI_Mm01_00039883 predicted 396
5 SASI_Mm01_00039884 predicted 446
6 SASI_Mm01_00039885 predicted 5641
7 SASI_Mm01_00039886 predicted 3805
8 SASI_Mm01_00039887 predicted 2952
9 SASI_Mm01_00039889 predicted 1334
10 SASI_Mm01_00039890 predicted 1897
11 SASI_Mm01_00039888 predicted 5643
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001520
VALIDATED
GTF3C1 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIC, polypeptide 1, alpha 220kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001520.1-6693s1c1
Sequence:CCGGCACCTCACATTCCAGACTCTACTCGAGTAGAGTCTGGAATGTGAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001520.1-6045s1c1
Sequence:CCGGCCTTCCTGTATGCAAGGGTATCTCGAGATACCCTTGCATACAGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001520.1-4675s1c1
Sequence:CCGGCCTGATCGTTTCTCTTTCAAACTCGAGTTTGAAAGAGAAACGATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001520.1-402s1c1
Sequence:CCGGCCGCTACTTTAAGGAGAGGAACTCGAGTTCCTCTCCTTAAAGTAGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001520.1-1273s1c1
Sequence:CCGGCGACTTCTTCAAAGATTCAAACTCGAGTTTGAATCTTTGAAGAAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001520.2-1922s21c1
Sequence:CCGGCTTCGCTTAATCGAGAGTTTACTCGAGTAAACTCTCGATTAAGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001520.2-910s21c1
Sequence:CCGGTAAGCGTCTGTACCAGTATATCTCGAGATATACTGGTACAGACGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001520.2-2518s21c1
Sequence:CCGGCAGTGAACGGAGAACGATAAACTCGAGTTTATCGTTCTCCGTTCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001520.2-4022s21c1
Sequence:CCGGCAGGCCTATCTCAACTATAAACTCGAGTTTATAGTTGAGATAGGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001520.2-6505s21c1
Sequence:CCGGAGTCACAGACTGACACGTTTCCTCGAGGAAACGTGTCAGTCTGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001520
VALIDATED
GTF3C1 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIC, polypeptide 1, alpha 220kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001520.1-6693s1c1
Sequence:CCGGCACCTCACATTCCAGACTCTACTCGAGTAGAGTCTGGAATGTGAGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001520.1-6045s1c1
Sequence:CCGGCCTTCCTGTATGCAAGGGTATCTCGAGATACCCTTGCATACAGGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001520.1-4675s1c1
Sequence:CCGGCCTGATCGTTTCTCTTTCAAACTCGAGTTTGAAAGAGAAACGATCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001520.1-402s1c1
Sequence:CCGGCCGCTACTTTAAGGAGAGGAACTCGAGTTCCTCTCCTTAAAGTAGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001520.1-1273s1c1
Sequence:CCGGCGACTTCTTCAAAGATTCAAACTCGAGTTTGAATCTTTGAAGAAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001520.2-1922s21c1
Sequence:CCGGCTTCGCTTAATCGAGAGTTTACTCGAGTAAACTCTCGATTAAGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001520.2-910s21c1
Sequence:CCGGTAAGCGTCTGTACCAGTATATCTCGAGATATACTGGTACAGACGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001520.2-2518s21c1
Sequence:CCGGCAGTGAACGGAGAACGATAAACTCGAGTTTATCGTTCTCCGTTCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001520.2-4022s21c1
Sequence:CCGGCAGGCCTATCTCAACTATAAACTCGAGTTTATAGTTGAGATAGGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001520.2-6505s21c1
Sequence:CCGGAGTCACAGACTGACACGTTTCCTCGAGGAAACGTGTCAGTCTGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001520
VALIDATED
GTF3C1 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIC, polypeptide 1, alpha 220kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017318    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001520.1-6693s1c1
Sequence:CCGGCACCTCACATTCCAGACTCTACTCGAGTAGAGTCTGGAATGTGAGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001520.1-6045s1c1
Sequence:CCGGCCTTCCTGTATGCAAGGGTATCTCGAGATACCCTTGCATACAGGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001520.1-4675s1c1
Sequence:CCGGCCTGATCGTTTCTCTTTCAAACTCGAGTTTGAAAGAGAAACGATCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_001520.1-402s1c1
Sequence:CCGGCCGCTACTTTAAGGAGAGGAACTCGAGTTCCTCTCCTTAAAGTAGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001520.1-1273s1c1
Sequence:CCGGCGACTTCTTCAAAGATTCAAACTCGAGTTTGAATCTTTGAAGAAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001520.2-1922s21c1
Sequence:CCGGCTTCGCTTAATCGAGAGTTTACTCGAGTAAACTCTCGATTAAGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001520.2-910s21c1
Sequence:CCGGTAAGCGTCTGTACCAGTATATCTCGAGATATACTGGTACAGACGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001520.2-2518s21c1
Sequence:CCGGCAGTGAACGGAGAACGATAAACTCGAGTTTATCGTTCTCCGTTCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001520.2-4022s21c1
Sequence:CCGGCAGGCCTATCTCAACTATAAACTCGAGTTTATAGTTGAGATAGGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001520.2-6505s21c1
Sequence:CCGGAGTCACAGACTGACACGTTTCCTCGAGGAAACGTGTCAGTCTGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_133826
VALIDATED
GTF3C1 MISSION shRNA Bacterial Glycerol Stock
general transcription factor IIIC, polypeptide 1, alpha 220kDa
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_133826.5-3871s1c1
Sequence:CCGGGCCTTTCTCTTTAGCAACTTTCTCGAGAAAGTTGCTAAAGAGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133826.5-2851s1c1
Sequence:CCGGCTACTGTATAAGAGGCGGTATCTCGAGATACCGCCTCTTATACAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_133826.5-341s1c1
Sequence:CCGGGCCGATACTTTAAGGAGAGAACTCGAGTTCTCTCCTTAAAGTATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133826.5-1836s1c1
Sequence:CCGGCCGACTGCTAAAGCGCAGAAACTCGAGTTTCTGCGCTTTAGCAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133826.5-1328s1c1
Sequence:CCGGGCCGACAATATGCTCGTGAAACTCGAGTTTCACGAGCATATTGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_133826
VALIDATED
GTF3C1 MISSION shRNA shRNA Plasmid DNA
general transcription factor IIIC, polypeptide 1, alpha 220kDa
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_133826.5-3871s1c1
Sequence:CCGGGCCTTTCTCTTTAGCAACTTTCTCGAGAAAGTTGCTAAAGAGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133826.5-2851s1c1
Sequence:CCGGCTACTGTATAAGAGGCGGTATCTCGAGATACCGCCTCTTATACAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_133826.5-341s1c1
Sequence:CCGGGCCGATACTTTAAGGAGAGAACTCGAGTTCTCTCCTTAAAGTATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133826.5-1836s1c1
Sequence:CCGGCCGACTGCTAAAGCGCAGAAACTCGAGTTTCTGCGCTTTAGCAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133826.5-1328s1c1
Sequence:CCGGGCCGACAATATGCTCGTGAAACTCGAGTTTCACGAGCATATTGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_133826
VALIDATED
GTF3C1 MISSION shRNA Lentiviral Transduction Particles
general transcription factor IIIC, polypeptide 1, alpha 220kDa
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086648    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_133826.5-3871s1c1
Sequence:CCGGGCCTTTCTCTTTAGCAACTTTCTCGAGAAAGTTGCTAAAGAGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133826.5-2851s1c1
Sequence:CCGGCTACTGTATAAGAGGCGGTATCTCGAGATACCGCCTCTTATACAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_133826.5-341s1c1
Sequence:CCGGGCCGATACTTTAAGGAGAGAACTCGAGTTCTCTCCTTAAAGTATCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133826.5-1836s1c1
Sequence:CCGGCCGACTGCTAAAGCGCAGAAACTCGAGTTTCTGCGCTTTAGCAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_133826.5-1328s1c1
Sequence:CCGGGCCGACAATATGCTCGTGAAACTCGAGTTTCACGAGCATATTGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)